0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot

Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot

Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot

... 2006 The Authors Journal compilation ª 2006 FEBS Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley Consequences of a chronic ... monomeric antenna proteins(CP26, CP29 and LHCII monomers) (band 2), and tri-meric LHCII (band 3), monomeric (band 4) and dimeric (band 5) PSII cores. Bands 6 and 7 containedsupramolecular complexes ... profile of bands 6 and 7 from the WT and mutant (Zb63). Photosystem I (PSI) core major polypeptides(PsaA and PsaB), ATPase subunits and PSIIantenna polypeptides (Lhcb) are indicated,as identified...
  • 15
  • 476
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...
  • 9
  • 626
  • 0
Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx

Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx

... phosphorylasefrom the Archaeon Pyrococcus furiosusGiovanna Cacciapuoti1, Sabrina Gorassini1, Maria Fiorella Mazzeo2, Rosa Anna Siciliano2,Virginia Carbone2, Vincenzo Zappia1 and Marina ... (time-zero control) and at different time inter-vals, aliquots were removed from each sample and analyzedfor activity in the standard assay. Activity values areexpressed as a percentage of the zero-time ... City, CA, USA), as alreadydescribed [57]. In the m ⁄ z range 4000–40000 mass spectrawere acquired in linear positive-ion mode and calibratedusing as internal standards the average double and...
  • 14
  • 384
  • 0
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf

... 5¢-AAGATGAAACGTGAGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAATAC-3¢ (CA2). The 3¢ region of the hazelnut LOX cDNAwas amplified using the following primers: 5¢-GTTTGGAAGAGAGATGCTGG-3¢ (CA3); 5¢-AAAGTTTTTAGATTGAGACACTATTGGGAATT-3¢ ... were obtained byPCR using hazelnut genomic DNA as template, theprimers 5¢-CTATGATTATGATGTCTACAATGATTTGGG-3¢ (ML1) and 5¢-GCAAATTCTTCATCAGTCATCCATGCAGAC-3¢ (ML2) and the following amplificationconditions: ... Nucleotide and deduced amino acidic sequences of thehazelnut LOX gene. The inverted repeats are in bold and their orientations are indicated by arrows. TATA and CAAT boxes and the initiatingATG are also...
  • 11
  • 404
  • 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... developmental cycle: early, middle and latesubstrate colonization stages (4, 8 and 12 days); pinheadstage (day 14), button stage (day 18), egg stage (day 21),elongation stage (day 22) and mature stage ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5¢-AGCTTTCATTCCCAGTGATTG-3¢)andPLAC1R(5¢-AACGAGCTCAAGTACAAATGACT-3¢) ... serially diluted lac1 and gpd template DNA. A clear linear relationship between the amount of templateinputs and PCR amplification was obtained for both lac1(Fig. 3: right panel) and gpd (data...
  • 11
  • 703
  • 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

... 5¢-GCCACTTACTTGAACTTTGACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGCATTTGACATAGAAGCC-3¢,5¢-GCCACTTACTTGGACTTTAACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGACTTTGCGATAGAAGCCGG-3¢,5¢-GGACTTTGACATACAAGCCGGTATCGATGC-3¢,5¢-GGACTTTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGATCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, ... Osaka, Japan). Target primersfor the generation of D522N, D52 2A, D524N, D52 4A, E526Q, E52 6A and W66 4A mutations were 5¢-GCCACTTACTTGAACTTTGACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGCATTTGACATAGAAGCC-3¢,5¢-GCCACTTACTTGGACTTTAACATAGAAGCCGG-3¢,5¢-GCCACTTACTTGGACTTTGCGATAGAAGCCGG-3¢,5¢-GGACTTTGACATACAAGCCGGTATCGATGC-3¢,5¢-GGACTTTGACATAGCGGCCGGTATCGATGC-3¢ ... 9526E-mail: k-uegaki@aist.go.jpDatabase Structural data are available at the ProteinData Bank under the accession numbers 3A4 W (E52 6A substrate complex), 3A4 X(D52 4A substrate complex) and 3AFB(D524A...
  • 13
  • 514
  • 0
Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

... S, Dianzani I, Lattanzi P, Spada M,Romano V, Calı`F, Andria G, Ponzone A, Marra E &Piazza A (2001) Genetic heterogeneity in five Italianregions: analysis of PAH mutations and minihaplo-types. ... In detail, at least one BH4responsive allele was present in ten HPA I patients, 14HPA II patients and seven HPA III patients.Characterization and functional analysis of novelmutationsAmong ... Giancarlo Parenti4, Luciana Esposito6, Adriana Zagari1, Generoso Andria4 and Francesco Salvatore1,21 CEINGE–Biotecnologie Avanzate Scarl, Naples, Italy2 IRCCS – Fondazione SDN, Naples,...
  • 12
  • 491
  • 0
Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf

... A. Miyanaga et al.(Eur. J. Biochem. 271) Ó FEBS 2003Mutational and structural analysis of cobalt-containing nitrilehydratase on substrate and metal bindingAkimasa Miyanaga1, Shinya Fushinobu1, ... 5¢-GATCCAGTGCCAGTAGAACGGCGACTCGAG-3¢ (68r), 5¢-CACGTCGTCGTGTGCTCGCTCTGCTCCTGC-3¢ (109f), 5¢-GCAGGAGCAGAGCGAGCACACGACGACGTG-3¢ (109r), 5¢-CTCTGCTCCTGCACCCCATGGCCGGTGCTG-3¢ (114f), and 5¢-CAGCACCGGCCATGGGGTGCAGGAGCAGAG-3¢(114r). ... the aT109S and aY114T structures, and a cobalt atom and three oxygen atoms in the apoenzyme and aY114Tstructures. Several rounds of refinement and modelÓ FEBS 2003 Mutants of Co-type NHase (Eur....
  • 10
  • 510
  • 0
Báo cáo khoa học: Biochemical and spectroscopic characterization of the bacterial phytochrome of Pseudomonas aeruginosa pdf

Báo cáo khoa học: Biochemical and spectroscopic characterization of the bacterial phytochrome of Pseudomonas aeruginosa pdf

... 5¢-GGTTACCCTGGCGAACGCCGAGGACGAACCCATCC-3¢;bphP C12S 5¢-GGTTACCCTGGCGAACTCCGAGGACGAACCCATCC-3¢; bphP H247Q, 5¢-GCAGCGTTTCGCCGATCCAGTGCGAATACCTGACC-3¢; bphP C24 8A, 5¢-CGTTTCGCCGA TCCACGCCGAATACCTGACCAAC-3¢ and bphP H51 3A, ... the P2 domain, which is often recognized as a PASdomain in the Pfam database (protein families data-base; http://www.sanger.ac.uk/Software/Pfam/) [12].PAS domains are tandem repeats first described ... AF, Palma LA & Lagarias JC(1989) Phytochrome chromophore biosynthesis. Treat-ment of tetrapyrrole-deficient Avena explants withnatural and non-natural bilatrienes leads to formation of spectrally...
  • 10
  • 412
  • 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... (R) CTCACCACAGACGATWTCCPLA5G2 (F) CGGTAAGCCCATAACGCCCAPLA3G2 (R) CAGGCCAGGATTTGCAGCCPLA3G4 (R) CATAAACAYGAGCCAGTTGCCARTF a (F) GAGTGGATGCACAGTCGTTGARTR a (R) GAAACGGAGGTAGTGACACATAtxBFb(F) ... GCCTGCTCGAATTCGGGATGAtxBrcb(R) CTCCTTCTTGCACAAAAAGTGAtxACFc(F) CTGCTCGAATTCGGGATGAtxACrcc(R) GTCYGGGTAATTCCTATATAAmlFd(F) GTGATCGAATTTGGGAAGATGATCCAAmlrcd(R) CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (F)CCCTATAGTGAGTCGTATTAT7 Promoter (R) CAGGAAACAGCTATGACPLA5G (F) CGGAATTCTGAAGGTGGCCCGCCAGGTGACAGPLA3G (R) CGCGGATCCAATCTTGATGGGGCAGCCGGAGAGGPLA5G1 (F) AGGAYTCTCTGGATAGTGGPLA3G1 (R) CTCACCACAGACGATWTCCPLA5G2...
  • 10
  • 451
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ