0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... sequencePrimerpairAnnealingtemp ( C) C5 3 (sense) GTGCTTGCGAATTCCCCGGGA C5 3 C2 03 60 C2 03 (antisense) CTCGAATTCAGTTGACGCCGTCTTCCAGAACCN294 (sense) CGTAGACCGTGCACCAGCACGAATCCTAAAC N294–N295 66N295 ... (antisense) GGAATTCCAGCGGTTTAAACTCAATGN222 (antisense) CTCGAATTCAGTTCACGCCGTCTTCCAG N298–N222 64 C5 4 (antisense) CTCGAATTCCACTAGGTAGGCCGAAG C5 3 C5 4 60 Expression of the HCV-1 core+1 protein N. Vassilaki ... the stability of the core+1 protein. However, no effect of the core+1 protein on core expression could bedetected. Expression of the core+1 ORF in Huh-7⁄T7 cells Expression in transfected Huh-7 cells...
  • 18
  • 365
  • 0
Báo cáo khoa học: Metabolic pathway that produces essential fatty acids from polymethylene-interrupted polyunsaturated fatty acids in animal cells pot

Báo cáo khoa học: Metabolic pathway that produces essential fatty acids from polymethylene-interrupted polyunsaturated fatty acids in animal cells pot

... acid-supplemented cells. In neither the control cells nor the cells cultured withdihomo -c- linolenic acid was it present at a detectablelevel. The formation of 16:2 D-7,10 and accumulation of linoleic acid in ... and ZP102 cells were incubated withsciadonic acid, sciadonic acid was incorporated into the cellular lipids of both (Fig. 5A ,C) . Sciadonic acid-dependent accumulation of linoleic acid and16:2 ... under the same experimental conditions. Interestingly, the efficacy of the conversion of 16:2 D-7,10 into linoleicacid was similar to that of c- linolenic acid intodihomo -c- linolenic acid, a common...
  • 10
  • 234
  • 0
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

... reaction can beconducted according to the ABC transporter pathway in which subsequent residues are added by the glycosyltransferases to the nonreducing end of the acceptor chainat the cytoplasmic ... reflected in the chemicalshifts of C1 of Fuc3NAc, which is downfield in comparisonto the other fragments. A change in the / and w angles hasbeen shown to give rise to a difference in the chemical ... deduced by an interresidual nOebetween the anomeric proton of the a-Fuc3NAc and the H1and H2 of the a-Rha and by the cross peak in the gHSQC-NOESY of the same anomeric proton to C2 of the...
  • 9
  • 454
  • 0
Báo cáo khoa học: Advanced glycation end products and lipopolysaccharide synergistically stimulate proinflammatory cytokine⁄chemokine production in endothelial cells via activation of both mitogen-activated protein kinases and nuclear factor-jB pdf

Báo cáo khoa học: Advanced glycation end products and lipopolysaccharide synergistically stimulate proinflammatory cytokine⁄chemokine production in endothelial cells via activation of both mitogen-activated protein kinases and nuclear factor-jB pdf

... reverse,5¢-GGGGGATCCCAAGTACTGTT-3¢) and GAPDH (for-ward, 5¢-CCCATCACCATCTTCCAGGA-3¢; reverse, 5¢-TGCTTCACCACCTTCTTGAT-3¢)at94 C for 30 s,56 C for 15 s and 72 C for 2 min, for 30 cycles. The expected ... synergistic effect on the induction of cytokines⁄chemokinesTo determine whether there is any combined effect of AGE-HSA and LPS on the induction of cytokines ⁄chemokines, we stimulated HUVECs with ... (forward, 5¢-CAGGAGCCCAGCTATGAACT-3¢; reverse, 5¢-TAAGTTCTGTGCCCAGTGGA-3¢),IL-8 (forward, 5¢-AGGGTTGCC AGATGCAATAC-3¢;reverse, 5¢-ACACAGCTGGCAATGACAAG-3¢), MCP-1(forward, 5¢-GTGAGGAGCCACCAACATTT-3¢;...
  • 9
  • 409
  • 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

... ATATAAGCTTATCCTCTGATAGCAK LF GACCCATCATCGAGGACTAAK SF ACCACAAGGGTTTCAAGCAGAK LR CCACACCAGGAAGGTCTTGTAK SR GGTGGAGGAAACCTTGGACTeIF4A LF ACGTCAACATGTCCGACAAAeIF4A SF CGGTGGAGACAACAAGGACTeIF4A LR TGCGTTTCGTTTGACTTCACeIF4A ... TGCTACAGCAACTGGTGATCAGAAGGGLR1 CCCTTCCTGATCACCATGTTGCTGTLR2 GGCCATCATACAGGTGACTAGGAGGGTLR3 GGGTGATTTGACACACGGTTTTGATGGAPWF1 ATGGGATATGTTCTCAGTCHH-SF ACAGATTTACGACTCCTCCTGES-SR CATGTTGCTGTAGCAGTTTGATPO-SR ATATAAGCTTATCCTCTGATAGCAK ... endocrine cells in the gut is associated with ecdysis in the crab Carcinus maenas. Proc Natl Acad Sci USA96, 13103–13107.2 Webster SG, Dircksen H & Chung JS (2000) Endocrine cells in the...
  • 12
  • 474
  • 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx

... E52D-rev:5¢-GCGCCACTTCTCGACGGGGTCGGTCAGCAGGC-3¢. E52H-fwd:5¢-GCCTGCTGAC C CACCCCGTCGAGAAGTGGCGC-3¢. E52H-rev:5¢-GCGCCACTTCTCGACGGGGTGGGTCAGCAGGC-3¢. E52Q-fwd:5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGGCGC-3¢. ... E52Q-rev:5¢-GCGCCACTTCTCGACGGGCTGGGTCAGCAGGC-3¢. Y70W-fwd:5¢-CTGCTGGAGCTGATGTGGAAAGATCCCAAGAAG-3¢. Y70W-rev :5¢-CTTCTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢. Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. ... Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢. R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢....
  • 10
  • 504
  • 0
Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

... [38,39].Splicing-speci c PCR was performed using the followingprimers: ‘a’, 5¢-TCTCCCAAAGCTTCTCGATGC-3¢ (for-ward primer speci c for the Noxo1 cDNA); ‘b’,5¢-CCCAAAGCTTCTCGGTCAGGC-3¢ (forward ... 3663–3677 ª 2006 The Authors Journal compilation ª 2006 FEBSGGCAGGCCCCCGATACCCAG-3¢ and 5¢-CGTCTCGAGGAGGCGGCCCGCAGCGCGAGA-3¢; sequences from the mRNA are underlined. With the two primers, PCR wasperformed ... primer, ‘d’, 5¢-CCGCGTTCTCCCAAAGCT-3¢ and primer c were used. 5¢-GAAATCCCATCACCATCTTCCA-3¢ (forward primer) and5¢-CCTTCTCCATGGTGGTGAAGAC-3¢ (reverse primer)were used for the glyceraldehyde-3-phosphate...
  • 15
  • 632
  • 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... RTnI96)181bound actin and TnC in the absence and presence, respectively, of Ca2+. Thesephenomena should directly reflect the mechanism of Ca2+switching involving the alternative binding of the C- terminal ... mollusks. In molluskantroponin, the activation is probably induced by streng-thening of the interaction between the structural TnC-binding site and the C- domain of TnC accompanyingCa2+binding ... site interacts with the C- domain of TnC in both the relaxed and contractile states, which plays a role in maintaining the structural integrity of the troponincomplex [17,18]. These switching mechanisms...
  • 12
  • 514
  • 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

... underlined, with the half site alsopresent in the operator in bold).Name Length (bp) Sequence1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT1DR 45 ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC1DR-short ... domain, which is involved in protein protein interactions in the dimeric RepA–operon complex, but which actually binds DNA in the monomeric RepA–iteron complex. Here, detailed fluorescence studies ... wild-type Cys residues (C2 9 and C1 06) have been changed to Ser. The singleremaining Cys160 is located on the C- terminal DNA-binding domain of RepA, also called the WH2domain, which specifically recognizes...
  • 15
  • 431
  • 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... La Jolla, CA, USA), was used for the mutation of Arg213 fi Ala. The oligonucleotides u sedwere: 5¢-gcgccaatcctggacgctgacgtcatcgacgcg-3¢ (forward)and 5¢-cgcgtcgatgacgtcagcgtccaggattggcgc-3¢ (reverse). ... 5¢-and3¢-ends, the respective attB1and attB2 recombination sites were: 5¢-taacagagccgaccgtcgcccgg-3¢ (forward primer) and 5¢-cttatgcgtgcaacgccctctt-3¢ (reverse primer). The PCR product was purifiedfrom ... that the architecture of the active sitecould accommodate an E600 inhibitor molecule covalentlybound to the catalytic Ser162 without d rastic conforma-tional changes (Fig. 4C) . The acyl binding...
  • 9
  • 584
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM