0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... FEBS Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles Asaka Yamane1,*, Mina Fukui1,*, Yoshiaki Sugimura1, Miho Itoh1, ... T, Fleckman P,Dale BA & Maki M (20 03) Analysis of epidermal-type transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytesusing monoclonal antibodies. ... 38 9,150–156. 33 Hitomi K, Kitamura M, Alea MP, Ceylan I, Thomas V& El Alaoui S (2009) A specific colorimetric assay for measuring of transglutaminase 1 and Factor XIII activi-ties. Anal Biochem 39 4,...
  • 11
  • 645
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... methyltransferase 1 and 3 towardthe Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, ... oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Althoughthe EWS activation domain is a potent transactivation domain that isrequired for the ... EMSA was performedwith RGG3 (lanes 2 and 4) and 32 P-labeled Htelo (lanes 1 and 2) orrHtelo (lanes 3 and 4). (B) EMSA was performed with RGG3 (lanes2 and 4) and 32 P-labeled rHtelo (lanes 1 and...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect Immun 66, 1891–1897.51 Caroff M, Tacken A & Szabo ... TGA TGA TGG CAA CTC (atr antisense) This studyasd1 AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin ... staining analysis with revert-ant O35ElpxX or O35ElpxL showed that an LOS bandmigrated in a manner identical to that of the parentalLOS. The LOS band of revertant O35ElpxX alsoshowed a change...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 706–7 23 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–4 83 Probe amplification for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG ... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAbrR2 AGA GCA GCA GAC CTT ACG ... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster -3 sequences(data not shown). By contrast, R. pachyptila aminoacid...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involved in ... 5A) .Although the same band was obtained after digestionFig. 3. 45Ca overlay analysis of fusions of GST and recombinantOMM-64 variants (rOMM-64-I-V and -C), containing differentdomains of ... hyaluronidase SD (25 munits, Y) and endo -a- N-acethylagalactosaminidase (70 munits, E). The HMWaggregate was digested only by heparitinase II (arrowhead), and a 64 kDa protein band appeared instead...
  • 12
  • 568
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD 237 904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA ... 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095 731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC 037 851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 1 73 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA...
  • 13
  • 563
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG -3 ,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG -3 , DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG -3 , DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG -3 . PAL0: 5¢-CGCAAGGTCATGACCTCG -3 . One strand of each ... domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and itsC-terminal extension. (B) Alignment of ligandbinding domain (E domain) (after ... 5¢-AAGATGGTATTGAAGATGATGGTTGA -3 ), purified from agarose gelusing Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32 P using a Metaprime kit (Amer-sham Pharmacia Biotech...
  • 16
  • 542
  • 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... osmoregulation.The discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembranetransport [1]. Aquaporins and aquaglyceroporins [the majorintrinsic protein ... Within the N-terminal regulatory domainS246P + Q592 stop TCTfiCCT + CAAfiTAA Between the N-terminal regulatory domain and TMD1K250E AAAfiGAA Between the N-terminal regulatory domain and TMD1G348D ... regulatory domainQ227R CAGfiCGG Within the N-terminal regulatory domainT 23 1A ACAfiGCA Within the N-terminal regulatory domainP 232 S CCTfiTCT Within the N-terminal regulatory domainP 236 L (found five...
  • 9
  • 383
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... )525(5¢-TGACCTTGTCTCGTTGCCTCACCC -3 )and )37 8(5¢-GCTACAGGGATGCCAAAAGAACCC -3 )fortheSite -3, and primer set )34 6 (5¢-GCGTCTCACCCTAGTCCTGGTCCTGC -3 )and) 214 (5¢-GGAAGGGGCGGGTCCAGAGAACA -3 ) for the ... and autoradiographed. Competitor DNAsused in EMSA analysis were: NF1 wt, 5¢-TTTTGGATTGAAGCCAATATGATA -3 ;NF1mut,5¢-TTTTGGATTGAATAAAATATGATA -3 ;Site-2wt,5¢-GCGTCTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTTTGTCC -3 ;Site-2mut,5¢-GCGTCTCACCCTAGTAATGGTAATGCTCCAAGGGTTTTTGTCC -3 ;Site-3wt,5¢-GGGTTCTTTTGGCATCCCTGTAGC -3 ;Site-3mut,5¢-GGGTTCTTTTTAAATCCCTGTAGC -3 .Chromatin ... Identification of NF1 as a silencer protein of the human adeninenucleotide translocase-2 genePeter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2 and B. Dean Nelson11Department...
  • 8
  • 426
  • 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... glycoformsobserved for strain NM115, whereas 3 Hex glycoformswere also observed for strains 425/ 93 and 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined ... H-4b-GlcNAc i 4.72 3. 81 3. 75 3. 75 3. 59 Gal-I H -3, Gal-I H-4ii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H -3, Gal-I H-4iii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H -3, Gal-I H-4b-Gal (Gal II) i 4.48 3. 55 3. 68 3. 93 ND ... O-deacylatedlipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3- OH C14:0fatty acid and a phosphate group. Variation in lipid A- OH...
  • 8
  • 361
  • 1

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015