Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot
Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot
... Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand Aitziber L. Cortajarena1, Jimin Wang1and Lynne Regan1,21 Department of Molecular Biophysics ... three TPR repeats (AB-helix pair) and anadditional C-terminal capping helix (A cap). The onlyway for molecules AB–AB–AB A capto arrange on‘head-to-tail’ packing is if the C-terminal A cap-helix ... wecreated a protein (CTPR390) that incorporates heatshock protein (Hsp)90-binding residues, grafted fromnatural Hsp90-binding TPR domains, onto the con-cave ligand- binding face of the domain (A- helices)...
- 9
- 330
- 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... first structure of a cold-adapted subtilase to be determined and its elucidation facilitatesexamination of the molecular principles underlying temperature adaptation in enzymes. The cold-adapted ... sta-tistical approaches analysing structural parameters in large samples of dissimilar proteins regarding the originand temperature range, do not show significant trendsregarding the polarity of protein ... determined, enables a more focused examina-tion of plausible determinants of different temperatureadaptation among subtilases.We crystallized the cold-adapted Vibrio proteinase in the presence of...
- 14
- 597
- 0
Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot
... HinCel 6A (Tyr104 and Glu108,Table 2. Amino acid residues interacting with the ligands or poten-tially involved in the catalysis, and the corresponding residues of HjeCel 6A, HinCel 6A and HinCel6B. ... 1.14 A ˚(CcCel6C–HjeCel 6A, 1QK0 chain A) and 1.30 A ˚(CcCel6C–HinCel6B, 1DYS chain A) formain chain atoms.The significant feature in cellobiohydrolasesHjeCel 6A and HinCel 6A is their active ... ligand binding produces a conformational change that narrowsthis tunnel. In contrast, the tunnel remains wide in CcCel6C and the con-formational change appears to be less favourable than in...
- 11
- 489
- 0
Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx
... hydrolysis of the critical b-lactam ring and renderthe antibiotic inactive against its original cellulartarget, the cell wall transpeptidase. b-Lactamases of Keywordsclass C b-lactamase; cold adaptation;psychrophile; ... enzymes.Frequently, alterations of the accessible surface of nonpolar side chains and of the accessible charged sur-faces are observed in cold-adapted enzymes. Polar andapolar accessible surface areas were ... B 6a, Lie`ge-Sart, Tilman, Belgiumb-Lactamases are the major causes of bacterial resis-tance to the b-lactam family of antibiotics, such aspenicillins and cephalosporins. These enzymes catalyzethe...
- 11
- 341
- 0
Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx
... using a- cyano-4-hydroxycinnamic acid (CCA) as the matrix.Protein crystallizationCrystallization trials were carried out using the hanging-drop vapor-diffusion method at 293 K. Crystals wereobtained a few days after ... Collen, D. & Lijnen, H.R. (1993) Interaction betweenstaphylokinase, plasmin(ogen), and alpha2-antiplasmin. Recycling of staphylokinase after neutralization o f the plasm in- staphylo-kinase c ... China;2Department of Molecular Genetics, Shanghai Medical University, ChinaStaphylokinase (SAK) is a 15.5-kDa protein from Staphy-lococcus aureus that activates plasminogen by forming a 1...
- 7
- 389
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx
... reaction with the inhibitors.Co-crystallization assaysCo-crystallization assays were carried out using a proteinsolution at 10 mgÆmL)1preincubated with 2 mMinhibitor.Crystals of the complex ... Cys166 andthe nicotinamide ring of the NAD+cofactor duringcatalysis. The average isotropic temperature factor valuesfor the main chain and all atoms of the 359 residues fromeach monomer are, ... Trypanosoma cruzi axenic amastigote intracellularform also suggest that carbohydrate catabolism is its majorsource of energy [4]. The glycolytic pathway of theseparasites is unique in that most of its...
- 13
- 588
- 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf
... underlined, with the half site alsopresent in the operator in bold).Name Length (bp) Sequence1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT1DR 45 ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC1DR-short ... SpainRepA is the DNA replication initiator protein of thePseudomonas plasmid pPS10. It is representative of a family of plasmid replication initiators active in manyGram-negative bacteria, including ... sequences, and relates to an increasedglobal rotational correlation time for the AEDANSprobe caused by C160–RepA binding to DNA (seebelow). Addition of DNA also induces a change in theshape of the...
- 15
- 431
- 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... importin -a structure thatincorporates the N-terminal autoinhibitory domain(PDB:1IAL, rmsd of 0.20 A ˚across 425 C a atoms in residues 72–496). The major binding site spanningARM repeats 2–4 has ... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma-tional rearrangement that exposes the NLS in an extended conformation.DatabaseStructural data are available in the ... ccp4 crystallography package [36].Scaling of intensities and inspection of data quality wereperformed in scala. In particular, the resolution cut-offwas determined by analysing the signal to noise...
- 14
- 741
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... andhydrolyze metal-free phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. ... maps and the location of errors in thesemodels. Acta Crystallogr A 47, 110–119.32 Nayal M & Di Cera E (1996) Valence screening of water in protein crystals reveals potential Na+bindingsites. ... the nativedata with a resolution of 1.68 A ˚. Iterative cycles of modelbuilding and refinement with arp ⁄ warp, refmac and oresulted in a final model containing 796 of 836 amino acids,804 water...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... residues of a putative trans-membrane region. The extracellular part of DESC1consists of a 120-amino acid SEA domain followed bythe C-terminal trypsin-like serine proteinase domain,as shown in ... revealsthat the most similar regions of these proteinases medi-ate interaction of the two b-barrels, formation of thecatalytic machinery and structures required for binding of the main chain of ... memberswithin the subfamily recognize largely nonoverlappingsubstrates.SurfaceHepsin was crystallized as a complete extracellulardomain including, in addition to the proteinasedomain, an N-terminal...
- 13
- 588
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ