0
  1. Trang chủ >
  2. Tài Chính - Ngân Hàng >
  3. Ngân hàng - Tín dụng >

Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term potx

Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx

... Gross Rate is the daily interest accrual rate. AER (Annual Equivalent Rate) illustrates what the interest would be if interest was paid and compounded each year. Our Annual Equivalent Rate (AER) ... reclaim.Annual Equivalent Rate (AER) illustrates what the interest would be if interest was paid and compounded each year. Our AER calculation assumes that the account is held for a year and that ... Fixed Deposit Accounts Accounts that give you a fixed rate of interest for a defined term. These rates are effective from the start of business on 1st November 2012Available in branch Fixed Deposit...
  • 5
  • 433
  • 0
Chart of Accounts: A Critical Element of the Public Financial Management Framework potx

Chart of Accounts: A Critical Element of the Public Financial Management Framework potx

... ManualsINTERNATIONAL MONETARY FUNDFiscal Affairs DepartmentChart of Accounts: A Critical Element of the Public Financial Management FrameworkPrepared by Julie Cooper and Sailendra PattanayakAuthorized ... 2011 1Chart of Accounts: A Critical Element of the Public Financial Management FrameworkPrepared by Julie Cooper and Sailendra PattanayakIntroduction1The chart of accounts (COA) is often considered—in ... integrated COA that conforms to accrual-based financial reporting standards (such as IPSAS) and can also be used for control and reporting of a cash-based budget. To avoid any ambiguity, the accounting...
  • 27
  • 654
  • 0
Báo cáo y học:

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

... arms, a heart rate of 74 beats/minute and an apical gallop sound (S4). Fe-moral pulses were palpable bilaterally but weak a nd delayed compared to the brachial pulses. His echo-cardiogram showed ... Publisher. All rights reserved Case Report A severe coarctation of aorta in a 52-year-old male: a case report Davran Cicek1, Cevahir Haberal2, Suleyman Ozkan3, Haldun Muderrisoglu4 1. Başkent ... School of Medicine, Department of Cardiology, Antalya, Turkey 2. Başkent University School of Medicine, Department of Cardiovascular Surgery, Antalya, Turkey 3. Acıbadem University, Department of...
  • 2
  • 487
  • 0
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... act is that utterances when issued perform an action (Austin, 1975). It means that actions that are cariied out through language are called speech acts. In the other way, speech acts are actions ... and social distances did have remarkable influence on the use of strategies and internal modification for each situation by both groups. At least two strategies are used for each situation. ... ways the Vietnamese and English encourage as a speech act. - To raise awareness of differences in communication among teachers and learners of English as well as other potential interactants...
  • 13
  • 1,583
  • 8
Tài liệu BONDS OF BLOOD AND HONOUR: A DUAL-STATTED INTRODUCTORY ADVENTURE FOR A GAME OF THRONES RPG WRITTEN BY JASON DURALL pptx

Tài liệu BONDS OF BLOOD AND HONOUR: A DUAL-STATTED INTRODUCTORY ADVENTURE FOR A GAME OF THRONES RPG WRITTEN BY JASON DURALL pptx

... Javier Gracia, Martin Heidemann, Matthew Hoffman, Andrea Keller, Sebastien Malangeau, Hans Manhave, Scott Martin, Darren Miguez, Shawn Moore, Eden Rabatsch, Jeff Rasar, Susan Ray, Darren Richley, ... spread along the road watching for any travellers heading towards Ameth village.Three of the men act as refugees or armed guards, and attempt to dissuade travellers by informing them that a ... to the player characters, several hours before their departure, Ser Anders sent one of his men-at-arms, Gervas, along the way to make a deal with bandits to harass and mislead the characters...
  • 24
  • 446
  • 1
Tài liệu Đề tài

Tài liệu Đề tài " Localization of modules for a semisimple Lie algebra in prime characteristic " pdf

... paper [BMR2]. The main result is obtained for a regular Harish-Chandra central character, and the most interesting case is that of an integral Harish-Chandra central character; integral regular ... the AzumayaalgebrasDXand τ∗ν(DX) are canonically equivalent.Proof. Recall that to establish an equivalence between two Azumaya al-gebras A, A on a scheme Y (i.e. an equivalence ... use a general observation that if a group H acts on a split Azumayaalgebra A with a center Z and a splitting module E is H-invariant (in the sense that gE∼=E for any g ∈ H), then the Morita...
  • 48
  • 424
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Shallow Model of Backchannel Continuers in Spoken Dialogue" potx

... pauses that are more indicative of an end -of- move boundary.It is evident from the language model that pauseplays an important role in the prediction of continuers. A quarter of all relevant ... test data. The validation data wasnecessary for building the CMU-Cambridge languagemodel, but was concatenated with the training set for the other models.The model was forced to back-off to a ... follow-ing Clark and Schaefer (1991), they include some-what more substantive ways of moving the conversa-tion forward, such as paraphrasing the speaker's utter-ance repeating part or all of it...
  • 8
  • 651
  • 0

Xem thêm

Từ khóa: writing a letter of interest for a teaching positionwriting a letter of interest for a positionwriting a letter of interest for a job positionwriting a letter of interest for a housewriting a letter of interest for a teaching position samplesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM