... said. "The realities I knew no longer exist, and I am
damp and cold. All about me is a sense of gloom and dejection. It is an
apprehension—an emanation—so deep and real as to be almost a ... It is an intangible and evasive—thing—but very
real. And it is coming closer! It has no organs of sight as I know them,
but I feel that it can see me. Or rather that it is aware of me w...
... said. "The realities I knew no longer exist, and I am
damp and cold. All about me is a sense of gloom and dejection. It is an
apprehension—an emanation—so deep and real as to be almost a ...
Richard Kadrey
Butcher Bird
Spyder Lee is a happy man who lives in San Francisco and owns a
tattoo shop. One night an angry demon tries to bite his head off
before he's saved by...
... SJ, Ward ER, Ryals
JA & Dangl JL (1994) Arabidopsis mutants simulating
disease resistance response. Cell 77, 565–577.
26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,
Miyao A, Kawasaki T, ... 1425.
39 Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa
U & Yasuda T (2002) Activation of AtMEK1, an Ara-
bidopsis mitogen-activated protein kinase kinase, in vitro
and in vivo: analysis of...
... specific advice on panic attacks (
☛ Box 5.3) or phobias (☛ Box 5.4).
My heart is beating fast
I must be having a heart attack.
My heart is beating fast
this is because I am tense
and when a ... person is tense,
the heart always beats fast.
I need to relax and
my heart will relax as well.
It doesn't matter whether
I have anything to say
this is a marriage an...
... (bas)
It is a group of schools in Ballarat, that provides the basis for interschool sporting competition
Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... Curriculum and assessment Authority (VCAA) manages and awards
school qualifications. It administers and awards two senior school secondary qualifications
known as the Victorian Certificate of...
... uterus,
spinal cord, salivary glands, and pancreas [43]. PAD I and
PAD III are expressed in epidermis and hair follicles (PAD
III) [43]. Mouse PAD IV has a potential nuclear
localization sequence and is ... pepti-
dylarginine deiminase).
Mouse cortical granules contain PAD
To ascertain if mouse cortical granules contain PAD, anti-
bodies made against mouse ePAD and human recom-
binant PAD...
... disRAS1fwd
5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC
CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA
CGC-3¢ and disRAS1rev CAAAACCATGTCATAT
CAAGAGAGCAGGATCATTTTCAACAAATTATGC
ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was
constructed to contain SUT2 as the only open reading
frame present in the plasmid ... 5¢-GACTGTCGATGATTATGGTTGCC
CGCTGGCTTCCAAACCCTTATCGATACCGTCGA
CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA
GGAAACAGCTATG...
... probe and a sense cDNA probe (complementary to
the antisense) for mouse Slc1 2a2 mRNA were designed as
follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT
CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT
CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.
All ... 110, 151–164.
26 Tomari S, Nagahama H, Shu Y, Hoshi S, Nakayama
K, Nakayama KI & Nagata M (2002) Glomerular dif-
ferentiation in p27 and p57 double-m...