The preference of a Female Greek island population in regard to the gender of their gynecologist pdf

... model, in which we included the variables that initially correlated with the choice of the sex and The preference of a Female Greek island population in regard to the gender of their gynecologist ... reported that they preferred a female doctor to take their Pap smear, 48% that they preferred a woman for their breast exam and 36% that they preferred a woman to take a sample of vaginal fluid ... skills, and also his/her bed manners are more important factors than the sex. Most patients do not have a gender The preference of a Female Greek island population in regard to the gender of their...

... activities of the a- 1 or the a- 2 isoforms of AMP-activated protein kinase (AMPK), increased phosphoryla-tion of acetyl-CoA carboxylase and a decrease in the tissuecontent of malonyl-CoA. Activation ... seen. A covalent activation leading to phosphorylation/inac-tivation of ACC, decreased malonyl-CoA and activation of CPT1 provides a novel insight into ways in which a ÔfeedforwardÕ activation of ... informationabout the fat fuel availability or the relative fat/carbo-hydrate availability. We are unaware of any previous report of a such an effect of fatty acid in vitro except thatKawaguchi et al....

... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary ar-tery disease (CAD; 4). Also the ... acti-vated and clotting time of 250 to 300 s. Patients re-ceived intracoronary nitroglycerin (0.1 to 0.2 mg) to achieve maximal vasodilatation before undergoing their initial and final angiograms. ... angiograms. The glycoprotein IIb/IIIa inhibitor (Tirofiban) was administered at the operator’s discretion. All patients maintained an-ti-platelet therapy following the procedure (aspirin 300...

... mentioned ear-lier, the loss of dopaminergic neurons in substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine in the striatum. As a result, ... evidence that MPTP andMPP+can facilitate aggregation of a- synuclein in the absence of any cellular machinery.It has been proposed that the auto-oxidation product of dopamine interacts with protofibrillar ... eluates were pooled and the amount of protein was determined by the bicinchoninicacid assay [38] using bovine serum albumin as a standardprotein. The pooled eluate fractions were dialysed againstwater...

... oAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcus119119119119119120119121118119159159159159157158157160158159199199199199197198197200198199VI ... GAPDHobtained by m olecular modelling (Fig. 1A) , and that of chloroplast spinach GAPDH [35] w ere examined t oAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcus119119119119119120119121118119159159159159157158157160158159199199199199197198197200198199VI ... wild-typerecombinant GAPDH shows that the beh aviour of R19 7A mutant is not affected b y the m utation, suggesting that the active site and the cofactor-binding site of the mutantR19 7A are not modified by the...

... this individual was troubled with a kind of insanitypeculiar to all headquarters, arising out of an exaggerated idea of his own importance. I had the pleasure, a few minutes afterward, of hearing ... the curling smoke of their pickets, a few miles away. The cleft of Manassas was plainlyvisible, and I traced the line of the Gap Railway to its junction with the Orange and Alexandria road, belowBull ... to cringe and prevaricate. The women were not generally handsome; their face was indolent, their dress slovenly, and their manner embarrassed. They lopped off the beginningsand the ends of their...

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...

... speeds and characteristics can be caused bychanges in elevation and by averaging time associated with a particular observation, as well as the topography androughness of the upwind terrain. In an ... being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the buildingenvelope (AAWE, 199 7a) . Two critical questions regarding the need ... No data are available on wind loads on buildings in the eye wall of a hurricane or in a tornado. No data onbuildings subjected to thunderstorms and tropical storms have been reported in the...

... signal(s) mediating the ZIP1 exocytotic arm of trafficking remains to bemapped. The [DE]XXXL[LI] signals in mammalian proteinsmediate rapid internalization and targeting to endo-somal–lysosomal ... (Fig. 1A) . The di-leucinesignal at amino acids 179–184 and the tyrosine-basedsignal at amino acids 285–288 are located within the predicted transmembrane domains that make themunlikely to be the ... Inoue K, Matsuda K, Itoh M, Kawaguchi H, TomoikeH, Aoyagi T, Nagai R, Hori M, Nakamura Y & Tan-aka T (2002) Osteopenia and male-specific sudden car-diac death in mice lacking a zinc transporter...

... the amino acidswithin the binding domain of RAMY protein and analyzed the time course for the induction of RAMY a nd a- amylasemRNA by GA.Correspondence to Q. Yao, Shanghai Key Laboratory of AgriculturalGenetic ... copies of O2S was synthesized by PCRusing two primers: Amyb1: 5¢-ACCCTCGAGGTCGACGGTATCGATAAGCTTGATTGACTTGACCGTCATCGGATTGACTTGACCGTCATCG-3¢,Amyb2:5¢-CAGGATCCATCACGACAGTCAGTGCCGATGACGGTCAAGTCAATCCGATG-3¢ ... prior to that of the Amy2 mRNA level in the GA-treated aleurone tissues. These data suggest thatRAMY may act as a trans-acting protein and is probablyinvolved in the GA-induced expression of the...