Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx

... What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information Darren Gergle Human-Computer Interaction Institute School of Computer ... referring behavior in shared visual contexts. First, a model of refer-ring behavior that integrates a component of shared visual information can be used to increase the robustness of interactive ... in the presence (or absence) of shared visual information. A successful computa-tional model of referring behavior in the pres-ence of visual information could enable agents to emulate many...

Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

... discovered as one of the autoantigensfor the autoantibodies from a patient with collagenvascular disease [18]. MAN1 is an integral membraneprotein of the INM and belongs to the LEM (Lap2-emerin-MAN1)-domain ... WHdomain binds DNA with nanomolar afﬁnity and the binding is further increased by the presence of the UHM domain [44]. Because the DNA binding site onMAN1 does not overlap with the Smad binding ... eventually lead to enhanced dephosphorylation of Smads and attenu-ated ⁄ terminated signal. The discovery that the INM protein MAN1 bindsSmads and antagonizes cytokine signaling also raisesthe...

Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx

... Events, and Relations An important property of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. ... Since contexts are introduced as a new class of objects in the language, we can quantify over them and otherwise talk about them. In particular, we can organize contexts into a lattice-like structure ... ourselves to binary relations, we can generalize our representation by introducing the predicate ROLE and making rolenames into individuals in the domain. ROLE(o, r, v) asserts that individual...

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... [70]. In all of the cases described above, mainly histidyl–FAD-containing enzymes, it appears that the func-tional benefit of acquiring and retaining a covalentflavin–protein link is to increase the ... artifi-cial covalent flavinylation (again, FAD is linked via an8-carbon rather than 8a- carbon linkage) resulted in anincreased kcatvalue with d-alanine from 1.5 s)1for the mutant enzyme, containing ... of binding fold. With regard to the latter, in most VAO-type covalent flavoproteins, the flavin is covalently linked to an amino acid that ispart of the FAD-binding domain, whereas in VAO, the corresponding...

Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx

... beenfound as major colorants in the scleractinian coralsM. cavernosa, Scolymia cubensis, Catalaphyllia jardinei, the corallimorpharian Ricordia ﬂorida and the alcyo-narian Dendronepthya sp. [10,12,27]. ... suggest that the animals face considerableenergy costs maintaining such high expression levels,at least, if protein turnover is fast. To date, no kineticdata are available on the degradation of GFP-like ... exponential decay func-tions. The variability in half-life values was estimatedfrom the maximal deviation of the individual timepoints. We obtained half-lives of mcavRFP of 13 ± 2days in green...

Báo cáo khoa học: "Combining Multiple Resources to Improve SMT-based Paraphrasing Model∗" pdf

... phrases to alleviatedata sparseness. Kauchak and Barzilay (2006) usedparaphrases of the reference translations to improveautomatic MT evaluation. In QA, Lin and Pantel(2001) and Ravichandran ... syntacticand context constraints in paraphrase generation to enhance the acceptability of the paraphrases. In ad-dition, we will extract paraphrase patterns that con-tain more structural variation ... Ravichandran and Hovy (2002) para-phrased the answer patterns to enhance the recall of answer extraction. In IE, Shinyama et al. (2002)automatically learned paraphrases of IE patterns to reduce the...

Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

... NEMO adaptorbridges the nuclear factor-kappaB and interferonregulatory factor signaling pathways. Nat Immunol 8,592–600.73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C ... trimers in the plasma mem-brane early after receptor ligation whereas the celldeath regulators FAS-associated via death domain(FADD) and caspase 8 are recruited to a pro-apopto-tic complex that ... FADD, FAS-associated via death domain;IjBa, inhibitor of kappaB alpha; IKK, IjB kinase; NEMO, NF-jB essential modulator; NF-jB, nuclear factor kappaB; RIP1, receptor-interactingprotein 1; RIP3,...

Báo cáo khoa học: Protein aggregation and amyloid ﬁbril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

... calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro-ﬁle above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a negative set that both sample well the amino acidspace ... natural amino acids (a3 v). Next, calculations are based on the sliding-win-dow averaging technique: a sliding window of a givenlength is chosen and the program calculates the aver-age of a3 v values...

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAATCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTGTCTAAATGCCTTAAGTCCTTGTGTAAGGGACGTATC, ... 5¢-GCGAGGACCAAGGGGATTCTGGAGCTGAACAAGGTGCAATTGTTGTACGAACAGGTGTGCCAGTCCTCC/5¢-GGAGGACTGGCACACCTGTTCGTACAATAATTGCACCTTGTTCAGCTCCAGAATCCCCTTTGGCCTCGC and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG. The ... 5¢-AAAGAATTCCTGTGGCAGGGGACCAGTGG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGGCGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAGGTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGCTGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGGTAGTAAAT; the EcoRI...

Báo cáo khoa học: "That’s What She Said: Double Entendre Identiﬁcation" doc

... cap-italizing the first letter of each sentence, tagging itwith the Stanford Parser (Toutanova and Manning,2000; Toutanova et al., 2003), and fixing several tag-ger errors (e.g., changing the tag of ... classifier. DEviaNT sets the cost of a false positive to be 100 times that of a falsenegative.4 Evaluation The goal of our evaluation is somewhat unusual.DEviaNT explores a particular approach ... (Mason, 2004; Shutova, 2010). Other ap-proaches train support vector machine (SVM) mod-els on labeled training data to distinguish metaphoriclanguage from literal language (Pasanek and Scul-ley,...

Xem thêm