Báo cáo khoa học: The outer membrane component of the multidrug efﬂux pump from Pseudomonas aeruginosa may be a gated channel pptx

... The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel Eisaku Yoshihara, Hideaki Maseda and Kohjiro SaitoDepartment of Molecular Life ... has been demonstrated to be acylated [34].Characterization of OprM The outer membrane components of the multidrug efflux pumps in P. aeruginosa havebeenassumedtoforma channel through which antibiotics ... functions as a gated channel allowing antibiotics to diffuse through the outer membrane of this organism.MATERIALS AND METHODSPurification of the outer membrane components of multidrug efflux pumpsThe...

Tài liệu Báo cáo khoa học: Speciﬁc membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... revealed the localization of thisinhibitor at vacuolar membranes.Results Membrane- binding properties of ICIn an attempt to detect and characterize the membrane binding of IC, a member of the ... stationary growth phase, suggestingthat ICis speciﬁcally associated with the vacuolarmembranes rather than the other cellular membranes. The lipid composition of subcellular membranes in the yeast ... phase was selectively relocalized at the vacuolar membranes and lumens during the station-ary phase.DiscussionPEBP from bovine brain, a mammalian homolog of IC,was originally isolated as...

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... revent the FP from immersing too d eeply into the apolar core of the membrane. Our data are alsocompatible with the observation that truncation of t he membrane- spanning region of HA2 to the extent ... loose a ssociation for the peptidein the membrane bilayer.Self-assembly can also b e analyzed by compositionalvariation of rhodamine-labelled p eptide, keeping the totalconcentration of labelled ... those calculated by assuming a single species of a ssociation of N monomers indicates a m ulti-modeassociation for the peptide analogues in the membrane bilayer. The data therefore imply a heterogeneous...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogenbond and a less favorable interaction. ... thisworkPresent addressCenter for Biomembrane Research,Department of Biochemistry and Biophysics,Stockholm University, SwedenDatabaseStructural data are available in the ProteinData Bank under the accession ... by the fact that PRTFDC1 has a Gly in the position of the proposed catalytic Asp of HPRT. In PRTFDC1, a water molecule at the position of the aspartic acid side chain position in HPRT might be responsible...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC...

Tài liệu Báo cáo khoa học: Post-translational modiﬁcation of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... with the Yersinia YpkA D27 0A mutant strain, Prof. James R.Bliska (University of California-Berkeley, USA) for the Yersinia pseudotuberculosis contact A mutantstrain, Dr C. Garrison Fathman (Stanford ... isolated from a buffy coat (NationalBlood Centre) were transfected using the Amaxa Nucleofec-tor system (Amaxa ⁄ Lonza, Cologne, Germany) with the Human Monocyte Nucleofector Kit (Amaxa) according ... concurred with the data from the gentamicin-based invasion assay. The ratio of intracellular to extracellular bacteria was muchhigher in the case of cells overexpressing OTUB1 com-pared with control...

Tài liệu Báo cáo khoa học: Post-translational modiﬁcations of the linker histone variants and their association with cell mechanisms docx

... taken from [44].ChickenH101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNKH110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNKH102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNKH103 a- A pTAAPA AK A K A K ATK ... DKH1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aKH1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afKH1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a K ufKK a ⁄ mKN afKH1.4 a- pS pTAAPK pTKKK ... pSS auK aK fK aKK NaKH1.3 a- STAAPaK pTKKK RaK pSS auK aK fK a KK NaKH1.4 a- STAAPaK pTKKA RaK pSS auK aK fK aKK NaKH1.5 a- pST A E P aK pSKKK RK TSaK K K K K N afKChickenH101 aKKR RTAaKK pSKKTKK...

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... reductaseSREBP-2NADPHPyruvateAcetyl-CoACitrateacetyl-CoAOxaloacetateOxaloacetateACLACCHMG-CoAHMG-CoA synthaseCitrateMalonyl-CoAPalmitateMalateMitochondriaFASACCSCDFatty acid ... indicating a relationshipbetween lipid metabolism and the parasympatheticresponse that may play a role in arrhythmogenesis.Regulation of sulfonylurea channels and other potas-sium channels ... kinase; ME, malic enzyme; ACL,acetyl-CoA lyase; ACC, acetyl-CoA carboxyl-ase; FAS, fatty acid synthase; SCD, stea-royl-CoA desaturase; GPAT, glycerolphosphate acyltransferase; DGAT, diacyl-glycerol...

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... con-tained in the database did not form subgraphs andappeared isolated. The relatively small size of the con-nected graph compared with all the entries in the data-base might be due, at least ... [46].An analysis of the topological modules of the Fig. 3(labelled A G) shows that they include structuraland ⁄or functional features. Table 3 summarizes the main structural and functional features ... Albert R, Jeong H & Barabasi AL (2000) Error andattack tolerance of complex networks. Nature 406,378–382.36 Ravasz E, Somera AL, Mongru DA, Oltvai ZN & Bar-abasi AL (2002) Hierarchical...

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... primer, 5¢-GAGAGAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeIsite; antisense primer, 5¢-GAGAGAAAGCTTCAAAACTGGGACAGTTG-3¢, HindIII site. The same method was used to amplify the codingsequence for the E.coliMGST, ... to the nucleo-tide sequence 10 655–11 080 in the E. coli genome with a GTG start. Sense primer, 5¢-GAGAGACATATGCCATCGGCCATTTTAAAG-3¢; antisense primer, 5¢ -GAGAGAAAGCTTCTAACGCAGGGAGAAAAC-3¢. ... BSA as a standard [62]. A. thaliana A plant cDNA displaying sequence homology to humanMGST3 was cloned from an Arabidopsis thaliana cDNAlibrary from immature green siliques [63]. Primers for the complete...

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf lam the nao de tom tat bao cáo khoa hoc báo cáo khoa học báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam