0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

... Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii Sandra Pucciarelli1,2, Cristina Miceli1 and Ronald Melki21Dipartimento ... eukaryotes, an isotype of b-tubulin (b-T1) from the Antarctic ciliate Euplotes focardii, was expressed in Escherichia coli. Folding analysis was performed by incubation of the 35S-labeled, denaturedb-T1 ... protozoa, CCT has been characterized at the genesequence level in the ciliate Tetrahymena pyriformis [19,20],in the diplomonadide Giardia lamblia and the parabasilideTrichomonas vaginalis [21]. From...
  • 7
  • 500
  • 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

... promoterTGA AGC TGG AAA CCA TCA TTC AAA ACA TTA GCA GGA ATT TTC 52 343Lower promoter GGA GTT CTG CCA GGG AAC CAC GAC AGG GGA GAA CGC CAC TTA 57 587Exon 1 GTG CTG CCT GAG AAG GAT TG GAA AGT GCC ... [5] a totalabsorption of the signal was apparent.Fig. 6. Double staining of cystatin F and ER. (A) Cystatin F was stained with a humancystatin F specific polyclonal antiserum and a FITC labelled ... 5511Regulated expression and intracellular localization of cystatin Fin human U937 cellsCarl-Michael Nathanson1, Johan Wasse´lius2, Hanna Wallin1 and Magnus Abrahamson11Department of Clinical...
  • 10
  • 536
  • 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... thaliana, Persea americana,Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), five gibberellinC20 oxidases (Arabidopsis ... (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, Spinacia oleracea and Marah macrocarpa), hyoscyamine 6b-hydroxylase from Hyoscyamus niger, the iron-deficiency-specific proteins 2 and 3 from Hordeum ... way asdescribed for the wild-type cDNA.Data base retrievalData base searches and sequence alignments were carriedout with the ENTREZ and BLASTsoftware (National Library of Medicine and National...
  • 9
  • 864
  • 0
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

... enzymecomplex from Carboxydothermus hydrogenoformansAfter cell breakage and separation of the membranefraction from the soluble fraction, 80–90% of the hydro-genase activity and 60–70% of the ... 2002(Applied Biosystems). The accuracy of external calibrationwas, in general, better than 0.02%.Amino acid sequence analysis Preliminary sequence data of the C. hydrogenoformansgenome was obtained ... encodes the Ni- and Fe-containing catalyticsubunit of CO dehydrogenase. A catalytically active CooSIdimer has been previously purified and characterized from C. hydrogenoformans [25]. The 89- and...
  • 10
  • 376
  • 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

... reverse) and GSP5b (5¢-GTGCATACAACGAAGGCAATCGAGGTCC-3¢, reverse)using MarathonTMcDNA Amplification Kit and Advant-ageÒ cDNA polymerase from Clontech (Heidelberg,Germany) according to the manufacturer’s ... yohimbine, the neurolepticreserpine, the antihypertensive ajmalicine and the anti-arrhythmic ajmaline. The complex chemical structure of ajmaline, an alkaloid from the Indian medicinal plant Rauvol a ... for the participating genes and to clarify the regulation of productsynthesis, with the aim of influencing the biosynthesis on a rational basis. The best known pathways comprise those of the flavonoid...
  • 10
  • 650
  • 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

... another catalytic pathway. Mg2+ and Ca2+didnot affect NaoA activity, and are therefore probably notnecessary for the oxidation. However, Cu2+stronglyinhibited the activity of NaoA, and Mn2+slightly ... coli.Purification and characterization of NaoAProtein extracts of BL21(DE3)/pNA101 were separated bygel filtration, anion-exchange column chromatography, and ultrafiltration. The purified NaoA was further ... bySDS/PAGE (Fig. 2). The data for NaoA purification aresummarized in Table 1. The specific activity of the purifiedNaoA was about 21 times higher than that of crude extract, and the yield was...
  • 6
  • 255
  • 0
Báo cáo y học:

Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

... such as Asia, Africa, Pacific Islands and the Arctic and the rate of HBsAg positivity ranges from 8% to 15%. In the low endemic area, such as Western countries, HBV is predominantly a disease of ... Africa. Genotype B and C are common in Asia; genotype D, in southern Europe, the Middle East, and India; genotype E, in West Africa and South Africa; genotype F, in South and Central America; ... genotype G, in the United States and Europe [1]. Genotype H was recently identified in individuals from Central America and California [2]. Several genotypes may be associated with the severity of...
  • 5
  • 450
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw ... 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its complementfor His8Ala (substituted nucleotides are underlined). ... Regulation of mouse hepatic alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase, a key enzyme in the tryptophan-nicotinamide adeninedinucleotide pathway, by hepatocyte nuclear factor4alpha...
  • 14
  • 601
  • 0
Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

... The TRAFproteins are characterized by a C-terminal homology domain of about 200 amino acids, called the TRAFdomain. The TRAF domain mediates homo- and hetero-merization of TRAF proteins and ... middle panel). The GFP-tagged TRAF domains of TRAF2 and TRAF3also localized to the cytoplasm whereas the TRAFdomain of TRAF1 showed nuclear and cytoplasmiclocalization (Fig. 6, right panel). ... afterprolonged bleaching cycles (Fig. 8). Together, these dataindicate that there is only a slow exchange of cytoplasmic and nucleus-localized TRAF4, indicating that nuclear and cytoplasmic TRAF4 may represent...
  • 11
  • 468
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP