Báo cáo Y học: Puriﬁcation and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

... the puriﬁcation and catalytic proper-ties of a membrane-bound enzyme complex from C. hydro-genoformans composed of a hydrogenase and a COdehydrogenases. The complex catalyzes the conversion of CO ... Fe-containing catalytic subunit of CO dehydrogenase. A catalytically active CooSIdimer has been previously puriﬁed and characterized from C. hydrogenoformans [25]. The 89- and 62-kDa polypeptideswere ... 5717compared to the hydrogenase subunits. A densitometricanalysis revealed a molar ratio of CooS to CooH, the catalytic subunit of the hydrogenase, of 2.1 ± 0.1 : 1 and a molar ratio of CooF to...

Báo cáo Y học: Puriﬁcation and biochemical characterization of some of the properties of recombinant human kynureninase pptx

... 4). This is a major difference of human kynureninase from other mammalian enzymes, suchas rat hepatic kynureninase, and may imply that previousreports of weak activity withL-kynurenine in ... theactive site and also pave the way for co-crystallization of enzyme substrate and/ or enzyme inhibitor complexes.These should allow further mechanistic investigation of the catalytic reaction ... spec-troﬂuorimetrically at 37 °C, with excitation of the product3-hydroxyanthranilate at 330 nm and emission at 410 nm and 310 nm and 417 nm respectively for anthranilate, bythe method of Shetty & Gaertner...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... D-amino acid in peptide link-age by an enzyme from frog skin secretions. Proc NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama ... Kubota I, Takao T, Shimonishi Y, Yasuda-Kamatani Y, Minakata H, Nomoto K,Muneoka Y & Kobayashi M (1991) Fulicin, a novelneuropeptide containing a D-amino acid residueisolated from the ganglia...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Puriﬁcation of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdeﬁnedastheamountofenzymethatliberatesreducing ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR ... (OH,USA), TOYOPEARL CM-650Mwas fromToyo Soda Mfg,Co. (Tokyo, Japan), Sephacryl S-200 HR was from Amer-sham Pharmacia Biotech AAB (NJ, USA), and Hydroxy-apatite (Fast Flow Type) was from Wako...

Báo cáo khoa học: Puriﬁcation and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

... homology and ability to catalyze the conjugation of glutathione to a broad range of electrophilic substrates inanimal organisms. These classes are named alpha, mu, pi,theta, sigma, kappa, zeta and ... Puriﬁcation and partial characterization of seven glutathioneS-transferase isoforms from the clamRuditapes decussatusPascal Hoarau, Ginette Garello, Mauricette Gnassia-Barelli, Miche`le ... to assign it to a GSTclass; this isoform is recognized by the three rabbitantisera (anti-alpha, anti-mu and anti-pi). It is nowaccepted that mu, alpha and pi mammalian GST classeshave a common...

Báo cáo Y học: Puriﬁcation and characterization of novel kininogens from spotted wolfﬁsh and Atlantic cod pdf

... biantennary and triantennary N-glycans that are terminated by a2 ,3-linkedsialic acids, a high number of which are O-acetylated. About1/3 of the glycans carry sulfate at N-acetylglucosamine units of ... water and analysed by MALDI-TOF MS.Phosphatase treatmentDry N-glycan samples were dissolved in 50 mMammoniumbicarbonate, and 1 U of calf intestinal alkaline phosphatase(New England Biolabs, ... like papain and ficin but they had noeffect on trypsin, a serine proteinase. Wolffish kininogencarried a2 ,3-sialylated biantennary and triantennary N-gly-cans with extensive sialic acid O-acetylation....

Báo cáo Y học: Puriﬁcation and characterization of three galactose speciﬁc lectins from Mulberry seeds (Morus sp.) ppt

... Puriﬁcation and characterization of three galactose speciﬁc lectins from Mulberry seeds (Morussp.)Tanzima Yeasmin, Md Abul Kashem Tang, Abdur Razzaque and Nurul AbsarDepartment of Biochemistry, ... the family Moraceae, part of the genus Morus. Itis a deep rooted perennial plant, widely distributed in Asia,Europe, Africa and Latin America in a wide range of climatic conditions varying from ... nonimmunoglobulin-typecarbohydrate recognition molecules that are involved inhemagglutination, lymphocyte transformation, inactivation of certain types of tumor cells and precipitation of certainpolysaccharides...

Báo cáo Y học: Puriﬁcation and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

... polymerase(Stratagene) was used to amplify vanXYCusingpAT704astemplate with primers A (5¢-GCTAGGTCTCAATGAACACATTACAATT-3¢)andB(5¢-TATGGAATTCTCATGCGAACTGCCTCA-3¢) that included BsaIandEcoRIrestriction ... the VanC phenotype, VanXYCmust specific-ally hydrolyseD-Ala-D-Ala with minimal activity againstD-Ala-D-Ser, a very different type of specificity.VanXYC, VanX-type and VanY-type enzymes ... VanXYC.Lane1,molecular mass standards (in kDa); Lane 2, partially pure VanXYCafter gel filtration chromatography. (B) Purification of MBP-VanXYC.Lane 1, molecular mass standards; lane 2, cytoplasm containingMBP-VanXYC;Lane3,MBP–VanXYCafter...

Báo cáo Y học: Puriﬁcation and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx

... and sequence analysis of the lipase and lipase chaperone- encodinggenes from Acinetobacter calcoaceticus RAG-1, and redeﬁnition of a proteobacterial lipase family and an analogous lipase chaperonefamily. ... sequence analysis [6].LipA demonstrates hydrolytic activity toward emulsions of both medium and long chain triacylglycerols (Fig. 3).Areas of olive oil and tricaprylin hydrolysis are clearly seen and ... here the puriﬁcation and characterization of LipA and discuss its potential as a biocatalyst in synthesis reactions and in the context of related biotechnological applications.MATERIALS AND METHODSMedia...

Báo cáo Y học: Puriﬁcation and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures ppt

... various divalent metal cations and EDTA on theactivity of SAP1 and SAP2. The standard assay A was used except thatthe phosphoenolpyruvate concentration was subsaturating (4 mM). Enzyme activity ... Electrophoretic patterns of CNBr cleavage fragments of SAP1 and SAP2. CNBr cleavage fragments were prepared from gel slicescontaining 3 lgofSAP1(lane1)andSAP2(lane2)andanalyzedonan SDS/14% PAGE minigel as ... respect-ively. SDS/PAGE, periodic acid-Schiﬀ staining and analyt-ical gel ﬁltration demonstrated that SAP1 and SAP2,respectively, exist as 84 and 57 kDa glycosylated monomers.SAP1 and SAP2 are purple...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP