Báo cáo khoa học: "RESOLVING A PRAGMATIC PREPOSITIONAL PHRASE ATTACHMENT AMBIGUITY" pptx

... RESOLVING A PRAGMATIC PREPOSITIONAL PHRASE ATTACHMENT AMBIGUITY Christine H. Nal~tani Department of Computer and Information Science, University of Pennsylvania, Philadelphia, PA 19104 emaih nakatani@linc.cis.upenn.edu ... cannot be computed a priori, so pragmatic PP -attachment ambiguities are among those that defy structural and lexical rules for disambiguation. Another criticism aimed at discourse-level approaches ... of these adverbial PPs reflects neither a complementation nor a modification relation. If attachment is dictated by complementation, an instrumental PP should al- ways appear as an argument...

Báo cáo khoa học: "TELEGRAM: A GRAMMAR FORMALISM FOR LANGUAGE PLANNING" pptx

... TELEGRAM: A GRAMMAR FORMALISM FOR LANGUAGE PLANNING Douglas E. Appelt Artificial Intelligence Center SRI International Menlo Park, California O. Abstract Planning provides the basis for a ... example illustrates how a language system can use an annotated unification gramar like TELEGRAM. Suppose that there are two agents operating in an equipment as- sembly domain, and that ... description (FDs). Each of the features in an FD has a value that can be either atomic or another functional description. A unification grammar is a large FD that characterizes the features of every...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ forTMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢for HAI-1 (26 cycles). The GAPDH-speciﬁc...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For-oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identiﬁcation of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...

Tài liệu Báo cáo khoa học: Resolving the native conformation ofEscherichia coli OmpA docx

... fragments of M-OmpA and I-OmpA displayed a band at a molecular mass of  7 kDa (Fig. 2A, lanes 1and 2), identiﬁed by N-terminal sequencing as frag-ment 264–325 (6.6 kDa). A western blot of a ... pellet was discarded, and the supernatant,containing soluble OmpA, was loaded onto a column ofSephacryl S-300 (1.6 · 60 cm, HiPrep; GE Healthcare,Piscataway, NJ, USA) that had been equilibrated ... by the manufacturer (Qiagen, Valencia, CA,USA). Alternatively, His–OmpA was extracted with LDSand puriﬁed by chromatography on a Sephacryl S-300column (1.6 · 60 cm, HiPrep; GE Healthcare), using...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... a heat block,and allowed to anneal until the block temperature haddecreased to room temperature.Assay procedureThe assay was run as a three-step assay: initial incubation ofthe sample and...

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 andloss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... combination of IFNa and TRAIL,relative to TRAIL alone.In view of the cleavage of caspase substrates such asBID and PARP, the effect of IFNa and TRAIL onthe DNA content of MCF-7 cells was also assessed,using...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed andquantified on a Fuji Bio-Imaging analyzer BAS-2500 usingIMAGE GAUGEV3.3 software.Chromatin and protein–DNA analysisMicrococcal nuclease (MNase) digestion and in situ cleavageby ... Biotechnology) and acetylated H3 (Upstate Bio-technology), and antibodies against specific modificationssuch as acetylated H3-K9 (Cell Signaling Technology) andH3-K14 (Abcam) and anti-H3 C-terminal (Abcam). ... yeast. Proc. Natl Acad. Sci. USA 97, 13708–13713.52. Rascle, A. , Johnston, J .A. & Amati, B. (2003) Deacetylase activityis required for recruitment of the basal transcription machineryand...

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... corpusRyo NagataKonan University8-9-1 Okamoto,Kobe 658-0072 Japanrnagata @ konan-u.ac.jp.Edward Whittaker Vera SheinmanThe Japan Institute forEducational Measurement Inc.3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004;Nagata et al., 2005; Nagata et al., 2006; Tetreault etal., 2010b). This is one of the most active researchareas in natural language processing of learner ... NorthAmerican Chapter of the ACL, pages 154–162.Joel Tetreault, Elena Filatova, and Martin Chodorow.201 0a. Rethinking grammatical error annotation andevaluation with the Amazon Mechanical Turk....

Xem thêm