Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

... Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat tDepartment of Computer Science and ... This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging task. We perform a statistical analysis that provides information that complements ... improved Kappa scores, and they serve as a gold standard for developing a probabilistic classifier. Using bias-corrected tags as gold-standard tags is one way to define a single best tag when...

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... words) to allow for realistic evaluation of performance and 185 Fa Adverbial Phrase Fc Comparative Phrase Fn Nominal Clause Fr Relative Clause G Possessive Phrase J Adjectival Phrase N Noun ... mnemonics of the feature-based grammar to the nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it ... of application domain. • Development of a manually-bracketed corpus (treebank) of the domain. • Creation of a grammar with a large coverage of a blind test set of treebanked text. Statistical...

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

... potassiumphthalate as a buffering agent (pH 5.5), 0.1 mm CuSO4 and 1% tyrosine as an indicator substrate was used. The trans-formants were streaked on the plates and grown for 7 days, and tyrosinase activity ... endonuclease sites to the 5¢ and 3¢ ends, respectively. The primers used were as follows:forward primer, GTT GGA ATT CCA TCA TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT ... 919628.36 Yamada Y (1983) Production of heat-resistantpolyphenol oxidase, Japanese patent 61115488.37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese...

Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx

... that the retrieval of an irregular form necessitates less computation than the retrieval of a regular form. This is so because unlike regular forms that have to be created/analyzed each ... specifications and the implementation of a particular concept of word-based lexicon to be used for large natural language processing systems such as machine translation systems, and compares it ... just a particular set of grammatical features such as category, gender, number, person, case, etc. A lexeme contains all the information shared by all the flectional forms of a given lexical...

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

... inves-tigation because of their physiological importance and their pharmaceutical relevance as drug carriers [1–6].Both transporters catalyse the uptake of most dipep-tides and tripeptides and a variety ... byunlabeled Bip-Pro itself, but also by well known sub-strates of H+⁄ peptide cotransporters, such as Gly-Sar,Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,d-aminolevulinic acid, cefadroxil ... amount of Bip-Pro in the extracellular uptake mediumwas quantiﬁed according to the laboratory standard HPLC(La-ChromÒ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and a...

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulﬁde reductase from Pyrococcus horikoshii Implications for the disulﬁde metabolism of anaerobic hyperthermophiles doc

... treated with dithiothreitol (5 mm) to reducethe disulfides, and assayed as above. Thiols were quanti-fied by comparison of peak areas to standard curves of those standards. Coenzyme A was measured ... theratio of protein concentration to flavin concentration(as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identityto putative NADH oxidases ... for the CoADR reaction.Thermostability and thermoactivity of the CoADRphCoADR is stable for months at both )80 °C and )20 °C, and has half-lives of > 100 and 39 h at 85° and 95 °C, respectively....

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... TAACCCCAATCTAGACAGTCCARA358 CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC ... CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460...

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... (5¢-GCGCGGGATCCTCATTTAAGCATGAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order tointroduce an NcoI restriction site, an extra alanine codon(GCA) was ... bivalent cations such as Zn2+ and Co2+ for activity and contains at least one zinc atom per subunit. Kmvalues for l-threonine and NAD+at 70 °C were 1.5 mm and 0.055 mm, respectively.AbbreviationsICP-AES, ... theinitial activity of Pf-TDH was checked using butane-2,3-diol as substrate in the standard oxidation reaction and acetoin in the reduction reaction. The activity of Pf-TDH was signiﬁcantly increased...

Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

... scions. A strong candidate for a transmissible jasmonate signal isthe JA-conjugate, MeJA. The volatile ester can diffusethrough membranes and c an be found in the headspaceabove w ounded leaves ... YTTRTCRCANACNACRTANACNCKRTGNACNSWNCCRTA for MJErev4 and GAYATGGCNGCNWSNG GNATHAAYCC for MJEfor3.1. With total RNA from cell suspen-sion cultures and primer MJErev4 for ﬁrst-strand synthesis,cDNA was ... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least inArabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate...

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... l-amino acids such as amino acidoxidases, transaminases, and racemases (epimerases). For example, in pea seedlings the occurrence of d-amino acid aminotransferase was demonstrated [36]. For a ... ground wasused for the analyses. (A) Total RNA was extracted and 20 lg RNAwas loaded in each lane and blotted as indicated in Experimentalprocedures. To prove equal loading of the extracted RNA ... Ohkishi H, Kawakami B, Yamano H,Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala-nine chloride-lyase (deaminating) of Pseudomonas putidaCR 1–1. Puriﬁcation and characterization of a novelenzyme...

Xem thêm