Báo cáo khoa học: "Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical Features" potx
Báo cáo khoa học: "Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical Features" potx
... traditional way.3 The grammatical featuresThe main goal of this paper is the incorporation of gramatical features to the WSME. Grammatical information may be helpful in many aplications of computational ... Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical FeaturesFredy Amaya and Jos´e Miguel Bened´ıDepartamento de Sistemas Inform´aticos y Computaci´onUniversidad Polit´ecnica ... Using Perfect Sam-pling in Parameter Estimation of a Wole Sentence Maximum Entropy Language Model. Proc. FourthComputational Natural Language Learning Work-shop, CoNLL-2000.F. Amaya, J. A. ...
- 8
- 332
- 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf
... (forward, 5¢-AAGGCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACAGGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco(forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢;reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin-specific ... attachedto a transilluminating base (Diagnostic Instruments, SterlingHeights, MI, USA). Photographs were taken using an Axio-Cam MRc 5 camera that was attached to the microscope.Image analysis ... plants, the average starting quantity of AtZFP11 was normalized to the average starting quantity of the a- tubulin gene, which is assumed to be at a constantlevels in all the samples. The Arabidopsis...
- 16
- 454
- 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... on SMT meth-ods need a language model and a paraphrase table.Both are computed on a training corpus.The language models we use are n-gram lan-guage models with back-off. We use SRILM (Stol-cke, ... future research tracks to improve para-phrase generation tools.2 Statistical paraphrase generation using transformation rulesThe paraphrase generation problem can be seen asan exploration problem. ... the constraint that any trans-formed part of the source sentence cannot be trans-formed anymore.This paradigm is more approriate for paraphrasegeneration than the standard SMT approach in re-spect...
- 4
- 338
- 0
Báo cáo khoa học: "Comparison of Alignment Templates and Maximum Entropy Models for Natural Language Understanding" docx
... allpossible target sentences:argmax { Pr (ejeifi')(1)The objective of natural language understanding(NLU) is to extract all the information from a nat-ural language based input which are ... this paper we present two approaches for an-alyzing the semantics of natural language inputsand discuss their advantages and drawbacks. Thefirst approach is derived from the field of statis-tical ... argmax r(ge,)•pr(ef) el1 IntroductionPr (f')Comparison of Alignment Templates and Maximum Entropy Models forNatural Language UnderstandingOliver Bender, Klaus Macherey, Franz...
- 8
- 367
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... MPTP andMPP+can facilitate aggregation of a- synuclein in theabsence of any cellular machinery.It has been proposed that the auto-oxidation product of dopamine interacts with protofibrillar a- synucleinand ... beneficial against a- synuclein aggregation in the substantia nigra parscompacta of an MPTP-induced mouse model of Parkinson’s disease [35]. It has recently been shownthat the protective action of...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... Ag-expressingendothelial cellpAloxP loxPpAtsA58TCAGtsA58TCAGEnzymatic digestion of organsCulture at 33 °CSerial passages every 2–3 daysat split ratio 1 : 3day 20–30day 0βgeoFig. 1. An endothelial...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... University of Utah, Salt Lake City, UT, USA3 Department of Physiology and Biophysics, University of Aarhus, Denmark4 Department of Medical Biochemistry, University of Aarhus, Denmark5 Department of ... 4753Application of a fluorescent cobalamin analoguefor analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factorSergey N. Fedosov1, Charles...
- 12
- 603
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc
... Ohno-Iwashita Y, Shimada Y, Waheed AA, HayashiM, Inomata M, Nakamura M, Maruya M & Iwashita S(2004) Perfringolysin O, a cholesterol-binding cytolysin,as a probe for lipid rafts. Anaerobe ... 10, 125–134.19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M,Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno-Iwashita Y (2001) Selective binding of perfringolysin Oderivative to cholesterol-rich ... clustering and segregation of Lck and LAT onthe inner leaflet of the plasma membrane [12]. Thesemorphological analyses suggest the existence of raftsubsets. There are some biochemical approaches...
- 10
- 588
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP