Báo cáo khoa học: "Compounding and derivational morphology in a ﬁnite-state setting" pptx

... linguistic information will be availableto address derivation/compounding. Since the nec-essary generative capacity is available in the syntac-tic grammar anyway, it seems reasonable to leavemore ... Compounding and derivational morphology in a ﬁnite-state settingJonas KuhnDepartment of LinguisticsThe University of Texas at Austin1 University Station, B5100Austin, TX 78712-11196, USAjonask@mail.utexas.eduAbstractThis ... part-of-speech category and morphosyntactic agreement in- formation, it is certainly important for informationextraction, information retrieval, and higher-leveltasks like machine translation.4An...

Báo cáo khoa học: "LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR" pdf

... "the' and "bucket' for (1, 'bury', 'the' and 'hatchet' for ¢2, and 'take', 'into' and 'account' for ,t3. The idiomatic ... LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR Anne Abeill6* LADL and UFRL University of Paris 7-Jussieu abeille@zeta.ibp.fr ABSTRACT according to this definition 2. Each elementary ... demande la lune # Ouelle lune demande-t-elle ? C'est la lune qu'clle demande ! # Jeanne demande la lune et Paule la demande aussi. (Jeanne is askin~ for the moon and i'm asking...

Báo cáo khoa học: "PARSING AND DERIVATIONAL EQUIVALENCE" pptx

... and suggestions in relation to this material, and Inge Bethke and Henk Zee- vat for reading a late draft. All errors are our own. The work was carried out by the alphabetically first author ... kind in a grammar undermines a methodological assump- tion of derivational uniqueness. Combinatory Logic and Combina- tory Grammar Combinatory logic (CL; Curry and Feys, 1958; Curry, Hindley ... John') However the grammar now exhibits derivational equivalence, with different derivations assigning the same meaning. In general a sequence A1 /A2 +A2 /A3 9 .A3 /A4 9."'9"An...

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. European Patent ApplicationNo. EP080113 1A1 .21 Abendroth J, ... evolution and structural analysis of N-carbamoyl-d-amino acidamidohydrolase provide insights into recombinantY. Cai et al. A novel high-activity D-hydantoinase from Jannaschia sp. CCS1FEBS Journal ... of Shanghai, Chinese Academy of Sciences, Shanghai, ChinaOptically pure d-orl-amino acids are used as inter-mediates in several industries. d-amino acids areinvolved in the synthesis of antibiotics,...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... entericaTyphimurum strain IFO12529 genomic DNA as the templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing ... pro-tein is made up of a nine-stranded b-sheet ﬂanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella typhimurium SurE A. Pappachan et al.5856 FEBS Journal 275 ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus ... puri-ﬁed, and annealed. The Not1 site in the resulting genewas removed using the complementary oligomers5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAACCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAATTATCGCCCCTCCCGCC-3¢ ... an N-terminal Nco1 cloning site.The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and thereverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3¢ were...

Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

... corpus was chosen as a startingpoint for our study since it allows a comparison withthe original SemEval task. We plan to use largeramounts of additional training data.We used an in- house ... LinguisticsModels and Training for Unsupervised Preposition Sense DisambiguationDirk Hovy and Ashish Vaswani and Stephen Tratz and David Chiang and Eduard HovyInformation Sciences InstituteUniversity ... parameters being estimated.As a starting point, we choose the standard ﬁrst-order Hidden Markov Model as depicted in Figure 1a. Since we train a separate model for each preposi-tion, we can...

Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

... onComputational Linguistics (COLING’10), Beijing,China.Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap-tation for patent machine translation in the ... Uefﬁng, Gholamreza Haffari, and AnoopSarkar. 2007. Transductive learning for statisticalmachine translation. In Proceedings of the 45th An-nual Meeting of the Association of ComputationalLinguistics ... learning has mostly been discussed un-der the name of multi-domain adaptation in thearea of statistical machine translation (SMT). Ifwe consider domains as tasks, domain adapta-tion is a special...

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... Cryphonectria parasitica [9] and in the biosynthesis of cinnabarinic acid, a fungal metaboliteproduced by Pycnoporus cinnabarinus that exhibits anti-microbial activity against various bacterial species ... °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a ﬁnal extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5¢-AGCTTTCATTCCCAGTGATTG-3¢)andPLAC1R(5¢-AACGAGCTCAAGTACAAATGACT-3¢) were designed accordingto ... 686–691.49. Kaviyarasan, V. & Natarajan, K. (1997) Changes in extracellularenzyme activities during growth and fruiting of Pleurotus cornu-copiae var. citrinopileatus.InAdvances in Mushroom...

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... target).Zebrafish maintenance and preparation of eggsTAB zebrafish were reared and maintained on a light ⁄ darkcycle essentially as described by Westerfield [49]. All experi-ments and fish maintenance ... JQ & Martindale MQ (1996) Dualorigins of mesoderm in a basal spiralian: cell lineageanalyses in the polyclad turbellarian Hoploplana inqui-lina. Dev Biol 179, 329–338.48 Lambert JD & ... transmembrane domain and theserine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea gigasFEBS Journal 272 (2005) 3424–3440 ª 2005 FEBS 3427Daf-1 C. elegansCrassostrea...

Xem thêm