Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

... Anchored Learning is toadd a unique feature a i(an anchor) to each trainingsample (we add as many new features to the model as there are training samples). These new featuresmake our data ... SVMchunker on anchored data (as the anchored data isguaranteed to be linearly separable, we can set averyhigh value to the C parameter, preventing any mis-classification), and then investigating either ... classification model in order to understandits inner working, strengths and weaknesses. We in- troduce two SVM-based methods – Model Tamper-ing and Anchored Learning – and demonstrate how a fine-grained analysis...

Báo cáo khoa học: "COMPARING TWO GRAMMAR-BASED GENERATION ALGORITHMS: A CASE STUDY" ppt

... 1: EAA's and SHDGA's Traversals of An Analysis Tree. 3. GENERALITY-WISE SUPERIORITY OF EAA OVER SHDGA The traversals by SHDGA and EAA as marked on the graph are stas. This means ... inefficiency and nondeterminism, and which EAA will handle in an efficient and deterministic manner. We also point out that only EAA allows to treat the underlying grammar in a truly multi-directional ... SHDGA'S AND EAA'S TRAVERSALS SHDGA traverses the derivation tree in the seman- tic-head-first fashion. Starting from the goal predicate node (called the root), containing a structured...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster-3 sequences(data not shown). By contrast, R. pachyptila aminoacid ... GTT ACT TCC GCA GCT AGG 466–483Probe ampliﬁcation for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616–634RpCAtrRprobe ... melanogaster and D. pseudoobscura, the mos-quitoes A. aegypti and A. gambiae, the clam T. gigas and larval sequences from the cnidarian F. scutaria. Finally, wechose an outgroup comprising a- CAs...

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... contains 21 proteins involved in mRNA binding. The 50S, or L, subunit contains 34proteins, binds to tRNA, and mediates peptidyl trans-fer. Shown in Fig. 4A is the base peak chromatogramfrom a ... using CAD. In addition, coupling nanoﬂowLC with our ETD technology increases the sensitivityof intact protein analyses, and with ongoing advance-ments in protein chromatographic fractionation, ... theresulting tandem mass spectra against a database ofspectra predicted for tryptic peptides of all known pro-teins. Thousands of proteins in cultured cells, tissues and biological ﬂuids have been...

Báo cáo khoa học "ADIABATIC TEMPERATURE RISE AND REACTION RATE OF MASS STRUCTURE IN LOTTE CENTER HANOI PROJECT " pptx

... location of hydration heat sensor and image 3. Analysis of internal restraining stress for mat foundation 3.1 The amount of hydration heat and adiabatic temperature rise In hydration heat ... 7 the hydration heat was about 80℃ at center and about 67℃ at surface when it reached the highest point. And at that time temperature difference between internal and external area was 12.9℃ with ... while inside of volume expands by high temperature from accumulating hydration heat. That is, difference between inside and surface of structure causes a thermal crack from occurring a restraining...

Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulﬁde isomerase from Conus marmoreus pdf

... (without insu-lin and PDI) was equilibrated at 25 °C, and the NADPHoxidation rate was recorded against a reference cuvette con-taining NADPH, EDTA and buffer only. Subsequently,insulin was added, ... cPDIcontains four thioredoxin domains and an acidic C-ter-minal tail (a, b, b¢, a and c). Two thioredoxin activesites (WCGHCK) are found in the a and a domains,respectively. The cPDI shares ... Oulu,Finland). Ni2+-chelating Sepharose Fast Flow resin and Q-Sepharose Fast Flow resin were obtained from Amer-sham Biosciences (Arlington Heights, IL, USA). TheRACE kit was obtained from Invitrogen...

Báo cáo khóa học: Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

... caldusvariants have been detected in diverse locations such asacidic hot springs in Yellowstone National Park (WY,USA), acid mine drainage in Iron Mountain (CA, USA) [3] and exposed pyritic ores in ... chains thatincreased absorbance at 290 nm. In this study, the assay wasused to monitor tetrathionate hydrolase activity in cellextracts during purification. Enzyme activity was measuredat ... 9.8) caused a strong binding to the cation resin and a rather high saltconcentration was needed to displace the protein again.The final purification of the tetrathionate hydrolase from A. caldus...

Báo cáo khoa học: Gonadotropin-releasing hormone and ovarian cancer: a functional and mechanistic overview docx

... the migration and invasion potential ofCaOV-3 and OVCAR-3 ovarian cancer cells. TheGnRH-induced increase in invasiveness and migratoryactivity was blocked by neutralizing antibodies againstMMP-2 ... 5509kinase-signaling pathways. Mol Endocrinol 12, 451–457.87 Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y,Hayakawa J, Tahara M, Hisamoto K, Kurachi H &Murata Y (2000) Activation of ... advancedepithelial ovarian carcinoma. A Gynecologic OncologyGroup study. Am J Clin Oncol 15, 125–128.110 Marinaccio M, D’Addario V, Serrati A, Pinto V &Cagnazzo G (1996) Leuprolide acetate as a salvage-therapy...

Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

... n-3PUFA ratio 2 from 2.1 in virgin gland to 1 in preg-nant gland, when individual PUFA content was ana-lyzed in the mammary gland, a signiﬁcant increase in n-3 DPA and EPA in pregnant glands ... increase in n-3 docosa-pentaenoic acid (DPA) and eicosapentaenoic acid(EPA) in the mammary gland following pregnancy.Alternation of the n-6 ⁄ n-3 ratio in favor n-3 fatty acid in mammary gland ... of mammary differenti-ation. Using MCF-10 mammary epithelial cells, weanalyzed the effect of DPA, EPA, and DHA on acti-vation of Jak2 and Stat5. Whereas DPA and EPAactivated Jak2 and Stat5,...

Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf

... C G ATGA acg-t c 480Cc-CATH1 actgtcccctcgctgccttccatccaataaaggtctttgctggtaaaaaaaaaaaaaaaa 531Cc-CATH2 TTG-CTGAg-gaataaa-ggggc gtgtg c-accaagc -a 517Cc-CATH3 g tc a cc c aataaa-c-g ttca-gct ... 397Cc-CATH3 G T G GCCGGTGGC AC G GC G 420Cc-CATH1 GGATACAACCTCTACCGGGCAATCAAGAGGAAGTGAgccgtccccagagctgctgtcacc 471Cc-CATH2 T AGA-GGTC-G GCTT TC-CTA TCA-C-T-GCCG T-G CA-G-T 457Cc-CATH3 CAT AAA C ... 60Cc-CATH2 T 60Cc-CATH3 60Cc-CATH1 CCCCTGGATTACAACCAGGCTCTGGCCCAGGCTGTGGACTCCTACAACCAACGGCCCGAG 120Cc-CATH2 T AGC CC G AT A 120Cc-CATH3 C 120Cc-CATH1 GTGCAGAATGCCTTCAGGCTGCTCAGCGCCGACCCCGAACCCGGCCCAAACGTCCAGCTC...

Xem thêm