Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx

... example again, we will find that the key phrase “Internet” can be in-ferred from the title phrase “Web”. As a matter of fact, key phrases often have close semantics to title phrases. Then a ... the title phrases are regarded as labeled samples, while the other phrases as unla-beled ones. That is, the information we have at the beginning about how to rank phrases is that the title phrases ... Key phrases are defined as the phrases that ex-press the main content of a document. Guided by the given key phrases, people can easily under-stand what a document describes, saving a great...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... numbergi:91782944) was ampliﬁed from genomic DNA of B. xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse ... opti-mized metal–ligand distances (Table 2) compare veryfavorably with data in the protein database, from which an average distance of 2.03 A ˚for Fe–N(His)was inferred [38], and a target distance ... ofDke1 and a structurally characterized cupin protein from Rubrivivax gelatinosus PM1 (Protein Data Bankidentiﬁer: 2O1Q) that has been functionally annotatedas acetyl ⁄ propionyl-CoA carboxylase...

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel ﬂuorescent probe pdf

... 488 nm was carriedout with an argon ion laser. Acquired images were analyzedusing image-pro plus 4.5 software.Materialso-Aminobenzenothiol was purchased from Fluka (Shang-hai, China). A stock ... 4,5-Dihydroxy-1,3-benzenedisulfonic acid disodium salt (Tiron) was from Shanghai Reagent Co. Ltd (Shanghai, China). All chemi-cals were of analytical reagent grade, and double-distilledwater was used throughout. RAW264.7 ... disappeared, and inthe IR spectrum, N–H (3245 cm)1) and C–H(3110 cm)1) also disappeared, while a C ¼ N absorp-tion band at 1618 cm)1appeared. All spectral dataindicated that a larger conjugated...

Báo cáo khoa học: Structural diversity of angiotensin-converting enzyme Insights from structure–activity comparisons of two Drosophila enzymes docx

... Authors Journal compilation ª 2005 FEBSEach domain is catalytically active, and both are cap-able of cleaving AI and BK. The ACE gene also givesrise to a second mammalian ACE, known as either ... 65–70.29 Towler P, Staker B, Prasad SG, Menon S, Tang J, Par-sons T, Ryan D, Fisher M, Williams D, Dales NA,Patane MA & Pantoliano MW (2004) ACE2 x-raystructures reveal a large hinge-bending ... Williams TA, Michaud A, Dani P, IsaacRE, Shirras AD, Coates D & Corvol P (1998) TheDrosophila melanogaster-related angiotensin-I-convertingenzymes ACER and ANCE: distinct enzymic character-istics...

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3and K. Ravi Acharya11 Department ... nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank underaccession numbers 2xog and 2xoiAbbreviationsPDB, Protein Data Bank; ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for thesubstrate-free PhyK and the substrate-loaded AppAthe averaged distance is only 1.87 A ˚.Distinct conformational changes ... phytate with pH optima in theacidic range. They consist of two domains, a large a ⁄ bdomain and a small a domain with the catalytic site atthe interface of the two domains [4,5]. HAPs can initi-ate ... similarity, the overall structure of Klebsiella phytase bears similar-ity to other histidine-acid phosphatases, such as E. coli phytase, glucose-1-phosphatase and human prostatic-acid phosphatase....

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different ﬂanking bases preference pptx

... 701–713.15 Prabakaran P, An J, Gromiha M, Selvaraj S, UedairaH, Kono H & Sarai A (2001) Thermodynamic databasefor protein-nucleic acid interactions (ProNIT). Bioinfor-matics 17, 1027–1034.16 ... were aligned computationally and the appearance of a base at each position in a motif was presented as a percentage fre-quency of all four kinds of base. The base with a frequency higherthan ... (1989) Calculation of proteinextinction coefﬁcients from amino acid sequence data.Anal Biochem 182, 319–326.19 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M,Yamaguchi-Shinozaki K & Shinozaki...

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... andammonia. They belong to a superfamily [1] thatincludes amidases, acyl transferases and N-carbamoyl-d-amino acid amidohydrolases, and they occur in bothprokaryotes and eukaryotes. Their applications ... the bar indicates the fractionassayed. (B) Reducing SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of  40 kDa. The contaminating band at60 kDa was identiﬁed as GroEL ... forming and maintaining the helix, and suggest thatoligomerization utilizing these or similar interactionsmay be common among microbial nitrilases, cyanidedihydratases and cyanide hydratases....

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... inducing plasma leakage, shock and hemorrhagic manifestations.Currently, there are no vaccines available against dengue virus, althoughseveral tetravalent live-attenuated dengue vaccines are in ... years as a result ofthe expansion of the Aedes aegypti mosquito to dif-ferent geographic areas, and DHF has spread from South East Asia to the Western Paciﬁc and theAmericas. A substantial ... clinical phases Ior II, and prevention through vaccination has become a major priority onthe agendas of the World Health Organization and of national ministriesof health and military organizations....

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

... linkedto formation of an iron-peroxy adduct prone to fragmen-tation [266]. A similar p aradigm also appears to a pply to theﬁnal step in aromatase (CYP19)-catalyzed biotransforma-tion of androgens ... J.N., Corina, D. & Akhtar, M. (1996) Themechanism o f the a cyl-carbon bond cleavage re action catalyzedby recombinant sterol 1 4a- demethylase of Candida albicans.(other names are: lanostero ... Mukai, M., Kitagawa, T.,Jitsukawa, K., Masuda, H. & Einaga, H. (1999) Synthesis andcharacterization of novel alkylperoxo m ononuclear i ron(III)complexes with a tripodal pyridylamine ligand:...

Xem thêm