0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

... 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢Antisense: 5¢-GCCTGAAGTTTTTGGTTCACAGTGAAATTT-3¢ SULT1 ST4 Sense: 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢Antisense: 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ SULT1 ST5 Sense: 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢Antisense: ... 5¢-AGTTCAACAAGGAACTGCAGGACGTGTTTG-3¢Antisense: 5¢-CACATGGCTATAAAATGGTTACATCTGTGT-3¢ SULT1 ST2 Sense: 5¢-TATGTAGGAGCTACAAGAAACATTGAAGGC-3¢Antisense: 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ SULT1 ST3 Sense: 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢Antisense: ... sense (5¢-CGCGGATCCATGAGCCGGAGAACAAGCGAAACT-3¢) and antisense(5¢-CGCGGATCCTTATATAGTGAAGCGTATTGGAAG A novel zebrafish cytosolic sulfotransferase S. Yasuda et al.3834 FEBS Journal 272 (2005) 3828–3837...
  • 10
  • 336
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... and the localization of Starmaker in zebrafish. Dev GenesEvol 214, 582–590.26 Murayama E, Okuno A, Ohira T, Takagi Y & Nagasa-wa H (2000) Molecular cloning and expression of anotolith matrix ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis...
  • 12
  • 568
  • 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharideconsistent with a composition ... (1075), an additional phosphate group and an additional PEtn moiety (1155) and one additional phosphate group and two additional PEtn moieties (1278). Relative intensity of each glycoform/phosphoform ... region at 5.07 and 5.39 p.p.m. and a minorsignal at 5.50 p.p.m. were determined to be gluco-pyranose amino sugars, from the appearance of theirspin systems and the fact that the H-2 resonances of...
  • 8
  • 361
  • 1
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC1– GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– ... GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGGÓ FEBS 2003 A novel CaM-binding site found in ammodytoxin A (Eur. J. Biochem. 270) 3019Vista, CA), digested with BamHI/HindIII...
  • 8
  • 401
  • 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

... for angiotensin II receptor (AT 1a) cDNAcloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward);5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse).Primers used for cannabinoid receptor-1 (CB-1) cDNAcloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TGCCCCCTGTGGGTCACTTTCT-3¢.Plasmids ... Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissuesYanbin Liang, Chen Li, Victor M. Guzman, William W. Chang, Albert J. Evinger III, Dyna Sao and David ... RNA for RGS5 wasabundantly expressed in aorta, skeletal muscle, smallintestine and brain, and at low levels in heart, placenta,liver, colon, and leukocytes [9,10]. RGS5 acts as a potent GTPase...
  • 9
  • 312
  • 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... werepurchased from Sigma.DNA manipulation and sequence analysisPlasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performedby the standard methods ... 11718–11728.27. Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi,K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of theLonproteasegenefromThermus thermophilus HB8 and char-acterization of ... kDa), and carbonic anhydrase (29 kDa)] is shownas the standard curve. The molecular mass of native Bt-Lon (s)wasestimated from the standard curve based on the elution volume of native Bt-Lon and...
  • 11
  • 505
  • 0
Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢ and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢ and the following conditions: annealing temperature 55 °C,25 cycles, Phusion polymerase used according to themanufacturer’s ... PhosphorImager. The percentage of release from position 2 was calculated as follows: area fatty acid ⁄ (area fatty acid +area lysoPtdCho). Pancreatic PLA2 was used as a positive control, and T. lanuginosus ... similarities withcastor bean acid lipase. Identification and cloning of a putative lipase from C. papayaBecause V. heilbornii is a close relative of C. papaya, and that both expressed sequence tag...
  • 14
  • 395
  • 0
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... (5¢-AATAGAGAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCGATCTTAATCTGCTCAA-3¢). A fragment carryingAt3g21260 cDNA was amplifed from A. thaliana RNA byRT-PCR. RNA was isolated from ... GLTP1PRON-BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAAGGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360promoter was amplified using primers 21360PRUXBA(5¢-AACGATCTAGATTAAGAATGTAATCACATTAGGGT-3¢) and ... activity assays A 1.8 kb DNA fragment carrying the At2g33470 promoterwas amplified from the A. thaliana Col-0 genome usingprimers GLTP1PROUXBA (5¢-AGACTGCTCTAGAATGGGTTTCTAAACCAACACGT-3¢) and GLTP1PRON-BAM...
  • 17
  • 300
  • 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... GGCAACGAGCAAGGTCCGAAGsapE–R 2590 R GACGTCGTGAGTGCCTCCGTGmopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGGmopB–R 3103 R AGTATCAAACCGTGCTGGTCTCCHeme protein identification in M. capsulatus O. A. Karlsen ... would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa. A search in the PROSITEdatabase of protein families and domains [12] withMCA2590 revealed two ... the supplied ‘RNAprotect BacteriaReagent Handbook’ with an additional DNase treatment onthe column. The RNA was dissolved in 50 lL of RNase-freewater and the A 260 and A 280values were determined....
  • 12
  • 392
  • 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

... Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka, Japan2 Department of Biological Sciences, Faculty of Science, Kanagawa University, Hiratsuka, Kanagawa, JapanAlthough ... bovine adrenal gland ferritin; and lanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al.824 FEBS Journal 272 (2005) 822–831 ª 2005 FEBSabsorbance data ... purification and partial characterization of a putative microtubule-associated protein (MAP) from bovine adrenal cor-tex with an approximate molecular mass of 250 kDa. The protein wasexpressed ubiquitously...
  • 10
  • 232
  • 0

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP