... active phosphite
dehydrogenase mutant and its application for NADPH
regeneration
Ryan Woodyer
1
, Huimin Zhao
2
and Wilfred A van der Donk
1,3
1 Department of Chemistry, University of Illinois at ... reduction of NADP. Phosphite concentrations (labeled or
unlabeled) were held at 2 m
M and the assay was started by the
addition of 2 lgofHis
6
-tagged PTDH in...
... 25% of the accessible
surface area of a monomer contributes to Ll
PDH
dimer formation. Whereas LlPDH and OaPDH have a
buried surface area of 5500 A
˚
2
, TbPDH has a larger
interface surface area ... smaller compound PEA
(Fig. 1B) and a water molecule are present and PEX
and PEA refined satisfactorily with occupancies of 0.7
Table 1. Data and refinement statistics....
... TA
CATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeI
fl-SpsB3 TA
GAATTCTTAATTTTTAGTATTTTCAGG EcoRI
tr-SpsB5 TA
CATATGCACCATCACCATCACCATATTGTTACACCATATA NdeI
pIsaA5 TA
CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC ... TA
CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoI
IsaA3Myc TA
GAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRI
Rao C. V. S. et al. S. aureus type I sign...
... 39,
507–510.
21 Terada Y, Sanbe H, Takaha T, Kitahata S, Koizumi
K & Okada S (2001) Comparative study of the cycliza-
tion reactions of three bacterial cyclomaltodextrin glu-
canotransferases. Appl Environ ... Tokyo,
Japan. Rhizopus sp. glucoamylase was obtained from Toy-
obo Co., Ltd (Osaka, Japan). BM CGTase was obtained
from Amano Enzyme Inc. (Aichi, Japan) and had a specific
ac...
... mutations
Mousumi Banerjee
1
, Hemalatha Balaram
2
and Padmanabhan Balaram
1
1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India
2 Molecular Biology and Genetics Unit, Jawaharlal ... in
enzymes: a study of triosephosphate isomerase and
comparison with methyl glyoxalsynthase. Adv Protein
Chem 66, 315–372.
45 Gunasekaran K, Ramakrishnan C & Balaram P (1996...
... by
invertebrates, and has three crystal phases: calcite, ara-
gonite and vaterite. Although calcite is the most stable
crystal thermodynamically, many organisms can form
metastable aragonite crystals ... found to have a molecular mass of 64 kDa, and to contain
two tandem repeats and a Glu-rich region. The structure of the protein
and that of its DNA are similar to those...
... absorption bands. Heme catabolism by
HOs of mammals, pathogenic bacteria, cyanobacteria
and probably insects is considered to have a similar
mechanism, because the characteristic absorption
bands of verdoheme ... degradation rate of GmHO-1, indi-
cated in Table 4, is comparable to that of SynHO-1 in
the presence of NADPH, FNR, and Fd, and also to
that of rHO-1 in the pres...
... consisting of a catalytic
domain, a linker region, and a C-terminal carbohy-
drate-binding module. A high apparent molecular mass
for intact Cel7 4A (105 kDa) was also reported by
Grishutin et al. [6]. ... (Northampton, MA, USA). The ther-
mal denaturation of Cel7 4A was completely irreversible,
and no transition was seen in a repeat scan; therefore, an
apparent T
m
was...
... t-butyl alcohol to the reaction medium, namely,
a better solubilization of thioanisole and an increase in the
catalytically active monomeric form of MP8.
Fig. 2. Activators and inhibitors of the ... change of the Fe(II) spin state and no
replacement of any of the two axial ligands of the iron,
His18 or RNO, by an amino acid side-chain of the
antibody protein.
Binding...
... The anchoring of a- carboxylate
and a- amino group in the external aldimine defines
automatically the positions of the a- proton and the side
chain of any bound amino ac id. The lability of the a- proton
observed ... 568, and 754 min and treated
as above. The theoretical values of isotopic exchange rates
were calculated, based on the assumption that the number
of operat...