Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... lack of automatic met-ric that is capable to measure all the three criteria in paraphrase generation. Two issues are also raisedin (Zhao and Wang, 2010) about using automaticmetrics: paraphrase ... another language F , each translation couldhave m candidates {e} which may contain potentialparaphrases for es. Our task is to locate the candi-date that best ﬁt in the demands of paraphrasing.2.1 ... two cri-teria in paraphrase generation: adequacy measuringthe semantic equivalency and paraphrase rate mea-suring the surface dissimilarity. As they are incom-patible (Zhao and Wang, 2010),...

Báo cáo khoa học: "Bayesian Learning of a Tree Substitution Grammar" potx

... obvious way to learn thesegrammars. In particular, learning procedures arenot able to take direct advantage of manually an-notated corpora like the Penn Treebank, which arenot marked for derivations ... Proceedings of the ACL-IJCNLP 2009 Conference Short Papers, pages 45–48,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLPBayesian Learning of a Tree Substitution GrammarMatt Post and Daniel ... treebanks annotated withTSG derivations, and a treebank parse tree of nnodes is ambiguous among 2npossible deriva-tions. One solution would be to manually annotate a treebank with TSG derivations,...

Báo cáo khoa học: Identiﬁcation of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC1– GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– ... GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGGÓ FEBS 2003 A novel CaM-binding site found in ammodytoxin A (Eur. J. Biochem. 270) 3019Vista, CA), digested with BamHI/HindIII...

Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

... TOC(0)(Beginning) Kanji, Hiragana, Number,Katakana, Alphabet (5:5)19 TOC(0)(End) Kanji, Hiragana, Number,Katakana, Alphabet (5:5)20 TOC(0)(Transition) Kanji→Hiragana,Number→Kanji,Katakana→Kanji, (25:25)21 ... accuracy of automatic mor-phological analysis was lower than that of manualmorphological analysis. As previously stated, toimprove the accuracy of the whole corpus we take a semi-automatic approach. ... indicate whetherit is a morpheme. When a string is a morpheme, a grammatical attribute is assigned to it. A tag desig-nated asa1isthus assigned one of a number, n ,of grammatical attributes assigned...

Báo cáo khoa học: Identiﬁcation of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... 389,150–156.33 Hitomi K, Kitamura M, Alea MP, Ceylan I, Thomas V& El Alaoui S (2009) A speciﬁc colorimetric assay for measuring of transglutaminase 1 and Factor XIII activi-ties. Anal Biochem 394, ... Graduate School of Bioagricultural Sciences, Nagoya University, Japan2 CovalAb, Villeurbanne, France3 Department of Dermatology, Hokkaido University Graduate School of Medicine, Sapporo, JapanIntroductionTransglutaminases ... & Caputo I (2005) Mammalian transgluta-minases: identiﬁcation of substrates as a key to physio-logical function and physiological relevance. FEBS J272, 615–631.14 Facchiano A & Facchiano...

Báo cáo khoa học: "Joint Learning Improves Semantic Role Labeling Kristina Toutanova Dept of Computer Science Stanford " pot

... predi-cate. For example, this template will be instantiatedas follows for the example candidate argument se-quence:[ voice:active ARG1,PRED,ARG4,ARGM-TMP]We also add a variant of this feature ... also report Frame Accu-racy (Acc.), the fraction of sentences for which wesuccessfully label all nodes. There are reasons toprefer Frame Accuracy as a measure of performanceover individual-argument ... de-pendencies among the labels of the semantic argu-ment nodes of a verb. A drawback of local modelsis that, when they decide the label of a parse treenode, they cannot use information about the labelsand...

Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

... 1999).Usually, entire documents are translated by humans,and the sentence pairs are subsequently aligned byautomatic means. A small parallel corpus can beavailable when native speakers and translators ... given for Arabic , but the approach is applica-ble to any language that needs afﬁx re-moval. Our resource-frugal approach re-sults in 87.5% agreement with a state of the art, proprietary Arabic ... AlAst$ArypTask: stem AlAst$ArypChoices ScoreAlAst$Aryp 0.2AlAst$Aryp 0.7AlAst$Aryp 0.8AlAst$Aryp 0.1......Figure 3: Scoring the StemHowever, this approach has several drawbacksthat...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... inenzymes: a study of triosephosphate isomerase andcomparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T (2000) Molecularmechanism of the nacreous layer formation in Pinctadamaxima. Biochem ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu Ofrom Corynebacterium ... Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the ﬁnal reaction mixture were analogous, but not iden-tical,...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ