Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf
... the purification and partial characterization of a putative microtubule-associated protein (MAP) from bovine adrenal cor-tex with an approximate molecular mass of 250 kDa. The protein wasexpressed ... 5, bovine adrenal gland ferritin; andlanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al.824 FEBS Journal 272 (2005) 822–831 ª 2005 FEBSabsorbance ... electrophoreticmobility of bovine liver ferritin, bovine adrenal cortexFig. 1. Amino acid sequence analysis of the 250 kDa protein. A cyanogen bromide digest of the 250 kDa protein was separated bySDS ⁄ PAGE, and...
- 10
- 232
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... C), for pGEX–EWS; EAD forward d(CGGAAT TCA TGG CGT CCA CGG ATT ACA G) and EADreverse d(CGC TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA ... used as probes are indicated above each lane.The DNA protein complexes were resolved by 6% PAGE and visu-alized by autoradiography.K. Takahama et al. Identification of Ewing’s sarcoma protein FEBS ... pGEX–KGG2 as a template and the followingprimers: KGG3-4 forward d(AGA CAA AGG TGG CTTCAA AGG TGG CCG) and KGG3-4 reverse d(CCA CCTTTG CCA CCT TTG AAC A) . PCR was conducted withpGEX–KGG3-4 as a template...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc
... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... viable bacteria was 100 CFU per lung. Clearance of M. catarrhalis was expressed as the percentage of bacterialCFU at each time point as compared with the number attime zero.Statistical analysisThe ... mean value was calculated.Bactericidal assay with normal human serumComplement-sufficient normal human serum was preparedand pooled from eight healthy adult donors. A bactericidalassay was...
- 14
- 674
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... found to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involvedin...
- 12
- 568
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA...
- 13
- 563
- 0
Báo cáo khóa học: Identification of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt
... Sweden;3Swansea Clinical School, University of Wales Swansea, UK;4School of Lifeand Health Sciences, Aston University, Birmingham, UKAquaporins and aquaglyceroporins mediate the transport of waterandsolutesacrossbiologicalmembranes.Saccharo-myces ... family] have been found in archea,eubacteria, fungi, plants, animals and human [2,3]. Aqua-porins facilitate the diffusion of water across biologicalmembranes while the closely related aquaglyceroporinsmediate ... is an atypical aquaglyceroporin as the highlyconserved NPA motifs in the B- and the E-loop are NPS(Asn-Pro-Ser) and NLA (Asn-Leu-Ala), respectively,sequences that are also found in the Plasmodium...
- 9
- 383
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... wt, 5¢-TTTTGGATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTTGGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGTCTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTTTGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAATGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt,5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut,5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢.Chromatin ... Identification of NF1 as a silencer protein of the human adeninenucleotide translocase-2 genePeter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2and B. Dean Nelson11Department ... Promega) were used for transfection. CAT and luciferase activities were measured as described [17].DNase I protection assayRat liver and HeLa nuclear extracts were prepared as described previously...
- 8
- 426
- 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharideconsistent with a composition ... (1075), an additional phosphate group and an additional PEtn moiety (1155) and one additional phosphate group andtwo additional PEtn moieties (1278). Relative intensity of each glycoform/phosphoform ... plate-grown strains by the hotphenol/water method and ethanol precipitation of theaqueous phase as described [12], yielding 12 mg LPS for each strain. O-Deacylated LPS (LPS-OH) was prepared as described...
- 8
- 361
- 1
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafficking of GABA A receptors to the plasma membrane [2,3].Keywordscalreticulin; GABA A receptor; GABARAP;phage ... association and dissociationrates were fitted as global parameters, whereas the maxi-mum response Rmaxwas fitted as a separate parameter for each binding sensorgram. The dissociation constant ... typical for nativelyfolded GABARAP [22]. The addition of CRT toGABARAP resulted in the disappearance of GABA-RAP resonances, a clear indication of binding(Fig. 3B). Only weak amide signals for...
- 13
- 560
- 0
Báo cáo khoa học: Identification of RNase HII from psychrotrophic bacterium, Shewanella sp. SIB1 as a high-activity type RNase H pot
... Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E,Nakamura H, Katayanagi K, Morikawa K & IkeharaM (1991) Stabilization of Escherichia coli ribonucleaseH by introduction of an artificial ... [10]. Bacterial RNases HI, eukaryotic RNases H1,and retroviral RNases H are members of the type 1RNase H family. Bacterial RNases HII, bacterialRNases HIII, archaeal RNases HII, and eukaryoticRNases ... RNase HII: a homologue of human major RNase H. Structure 8, 897–904.16 Muroya A, Tsuchiya D, Ishikawa M, Haruki M, Mori-kawa M, Kanaya S & Morikawa K (2001) Catalyticcenter of an archaeal...
- 12
- 371
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật