Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx
Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx
... Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide Johannes Oehlke1, Gerd Wallukat2, Yvonne ... form appearing in both cases atTable 1. Sequences of the PNA derivatives studied.Compound SequenceMAP KLALKLALKALKAALKLA-NH2I Fluos-GGAGCAGGAAAG-Lys(antisense)II Fluos-GGAGCAGGAAAG-MAP(antisense)III ... serumcomponents appear more likely to b e the reason here. Intracellular PNA concentration increases more rapidly after exposure of cells to PNA MAP-conjugate than tonaked PNA The quantity of cell-associated...
- 7
- 325
- 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GCCATGCTAGCAATCATCACCGTAGCHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423MIH-LF GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR ... GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC 100AK-SF AAACGGTCACCCTCCTTGAAK-SR ACTTCCTCGAGCTTGTCACG 1323282 J. S. Chung and S. G. Webster ... premoult.Materials and methodsAnimals and peptidesCarcinus maenas were collected using baited traps in theMenai Strait, UK, and maintained in a recirculatingseawater system under ambient conditions....
- 9
- 587
- 0
Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc
... b-1,6-GlcNAcbranched tri-antennary and tetra-antennary oligosac-charides in a 5b1[56]. Similarly, characterization of thecarbohydrate moieties in a 3b1from nonmetastatic and metastatic human melanoma cell ... M, YamaguchiN, Kangawa K & Taniguchi N (1993) Purification and characterization of UDP-N-acetylglucosamine: alpha-6-D-mannoside beta 1-6N-acetylglucosaminyltransferase(N-acetylglucosaminyltransferase ... (1993) Purification and characterization of UDP-N-acetylglucosamine: alpha-6-D-mannoside beta 1-6N-acetylglucosaminyltransferase(N-acetylglucosaminyltransferase V) from a human lungcancer cell...
- 10
- 477
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... 7.0) at a concentration of 0.5 mgÆmL)1. Spec-tra were obtained as the average of five successivescans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin)1.Steady-state tryptophan fluorescencemeasurementsMeasurements ... Salmon testesDNA and some analytical grade chemicals such as EDTA,Tris ⁄ HCl, CaCl2, NaCl and mineral oil were obtained fromSigma (St Louis, MO, USA). Salmon testes DNA for theenzyme activity ... Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: "What lies beneath: Semantic and syntactic analysis of manually reconstructed spontaneous speech" pdf
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 746–754,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLPWhat lies beneath: Semantic and syntactic analysis of ... utter-ances (about 72% of the annotated SSR data) canbe given a semantic analysis in the following sec-tions. For each well-formed and grammatical sen-tence, all (non-auxiliary and non-modal) ... of 54 neutral argument nodes directly as-signed as semantic roles were ARG1, and another33.3% were ARG0. Nearly a quarter of insertedarguments became part of a larger phrase serv-ing as a...
- 9
- 511
- 0
Tài liệu Báo cáo khoa học: "Prosodic Aids to Syntactic and Semantic Analysis of Spoken English" ppt
... the range of syntactic pos- sibilities and the parser will align tone group and move syntactic boundaries at a later stage. By integrating syntax and semantics, the Parser is capable of resolving ... "now" as a cue word rather than as an adverb. 7. DISCUSSION We have shown that by integrating prosody with syntax and semantics in a natural language parser we can improve parser performance. ... terms of available system functions. A dia- logue manager manages interaction with the speaker and retrieves database information, 3. PROSODY EXTRACTION As the input to the parser is spoken language,...
- 8
- 444
- 0
Báo cáo khoa học: Regulated expression by PPARa and unique localization of 17b-hydroxysteroid dehydrogenase type 11 protein in mouse intestine and liver pdf
... one containing a PPARa ligand, Wy-14 643(–), were separated by SDS ⁄ PAGE and analyzed by western blot-ting. After analysis, the transferred membrane was stained with Coomassie Brilliant Blue ... 3,17-androstanediol and abundant expression insteroidogenic tissues such as placenta and gonads havebeen described [7]. 17b-HSD11 also has a proteindomain of glucose ⁄ ribitol dehydrogenase, and ... incubated with secondary goat anti-(rabbitIgG) or anti-(mouse IgG) conjugated with fluorescein iso-thiocyanate (MP Biochemicals, Aurora, OH, USA) or with Alexa Fluor 594-labeled goat anti-(rabbit...
- 11
- 497
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... CAF-1 – a molecular link betweenrecombination and chromatin assembly during meiosisSatomi Ishii*,†, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata,Kengo Sakaguchi and ... 5¢-CGGGATCCATGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTCTCAGCGGCCGCATTCTTAT. CcCac1L-C: 382F, 5¢-CATGCCATGGTGTCAGGGGATGTAGAAATG; 812R,5¢-GAGATTTCAGTTTCGTCACTCGAGCGG. To over-express N-terminal hexahistidine-tagged ... CcLim15 asbait. A clone was isolated which had moderate aminoacid similarity with the largest subunit of humanCAF-1 (p150) [19] and the largest subunit of Saccharo-myces cerevisiae CAF-1 (Cac1,...
- 10
- 487
- 0
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... membrane, whereas PilW, PilQ and PilA4 are located in the inner and outer membranes. These data show thatPilMNOWQ and PilA4 are components of a DNA translocator structurethat spans the inner and outer ... proteinsPilMNOWQ and PilA4, and demonstrate that the pilMNOWQ genes areeach essential for natural transformation. We identified three differentforms of PilA4, one with an apparent molecular mass of 14 kDa, ... Gaidamakova EK, Matros-ova VY, Vasilenko A, Zhai M, Daly MJ, Koonin EV &Makarova KS (2005) Comparative genomics of Thermusthermophilus and Deinococcus radiodurans: divergentroutes of adaptation...
- 12
- 702
- 0
Báo cáo khoa học: Local stability identification and the role of key acidic amino acid residues in staphylococcal nuclease unfolding ppt
... mNaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1. Spectra were obtained as the average of fivesuccessive scans with a bandwidth of 1.0 nm and a scanspeed of 20 nmÆmin)1.Steady-state ... University of Minnesota College of Biological Sciences, St. Paul, MN, USAStaphylococcal nuclease (SNase) is a globular proteinthat consists of 149 amino acids with a molecular mass of about 16 kDa. ... Huey-Jen Fang1 and Tian-Yow Tsong2,31 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan2 Institute of Physics, Academia Sinica, Taipei, Taiwan3 Department of Biochemistry,...
- 8
- 462
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)