Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

... solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds Enzio M. Ragg1, Valerio Galbusera1, Alessio Scarafoni1, Armando Negri2, Gabriella Tedeschi2,Alessandro ... inhibitionassaysTrypsin (TPCK-treated from bovine pancreas), a- chymo-trypsin (TLCK-treated from bovine pancreas), BApNA and GPpNA were purchased from Sigma-Aldrich. Solutions of BApNA and GPpNA were ... distance data by dynamical simulatedannealing from a random array of atoms. FEBS Lett239, 129–136.58 Yip P & Case DA (1989) A New Method for Reﬁne-ment of Macromolecular Structures based...

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R,5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT-cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTACCTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTTCCAAGTGC-3¢ for GT-cDNA2 (3043 bp).Construction and ... 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCATCATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAAGTCATTATGGCGCAAA-3¢. First strand cDNAs weresynthesized using Superscript II RNase H–reverse tran-scriptase ... grass carp. The adaptor primersAP1 and AP2 were purchased from Clontech. Gene-speciﬁcnested primers for 5¢-RACE were: Primer A, 5¢-TGTCAGTCCTGTACAAAGAC-3¢ and Primer B, 5¢-CATCAGGCTTCCCCATA-3¢....

Báo cáo khoa học: Physical properties and surface activity of surfactant-like membranes containing the cationic and hydrophobic peptide KL4 potx

... collected from each sample between 15 and 70 °C. For each preparation, the analysis was repeatedtwo or three times. The standard microcal origin soft-ware was used for data acquisition and analysis. ... surfactant-likemembranes containing the cationic and hydrophobicpeptide KL4Alejandra Saénz1,*, Olga Canãdas1,*, Luı´s A. Bagatolli2, Mark E. Johnson3 and Cristina Casals11 Department of Biochemistry ... Segregation of saturatedchain lipids in pulmonary surfactant films and bilayers.Biophys J 82, 2041–2051.35 Canadas O, Guerrero R, Garcia-Canero R, Orellana G,Meneńdez M & Casals C (2004) Characterization...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations as well as assignments of additional peaksbased ... China Sea. Sephadex G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and triﬂuoroacetic ... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but...

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... antagonist activities [8]. Analytical data haveshown that the fatty acids in LPS of Chlamydiae have acylchains with up to 22 carbon atoms and also that 3-hydroxyfatty acids occur only with amide-linkage ... Negative ion MALDI-TOF mass spectrum of LPS from C. trachomatis serotype E.Fig. 2. Negative ion MALDI-TOF mass spectra of lipid A isolated from C. trachomatis serotype E (A) and L2(B) andfrom ... : 0 was the most abundantamide-linked fatty acid.Analytical HPAEC and NMR spectroscopyThe LPS of C. trachomatis serotype E was deacylated and the resulting phosphorylated carbohydrate backboneFig....

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... Double-stranded cDNA was syn-thesized from the mRNA with a cDNA synthesis kit(TaKaRa, Tokyo, Japan) and used as an abalone cDNAlibrary. cDNAs encoding abalone cellulase were amplifiedby PCR from ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... temperature until all free waterwas evaporated. After this, IR spectra were recorded atroom temperature and at 37 °C. Usually, the originalspectra were evaluated directly and a spectral analysis ... Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentansKlaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger Heine1,Jo¨ rg Andra¨1, ... Meyer, H.W. &Seydel, U. (1998) Characterization of the nonlamellar cubic and HII structures of lipid A from Salmonella enterica serovar Min-nesota by X-ray diﬀraction and freeze-fracture electron...

Báo cáo khoa học: Identiﬁcation and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... HepG2cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two speciﬁc primers For 6I 5¢-CGATGAATTCGTTAACGCTCATCACCATCACCATCACGGGAAATTGGCCATGGGGT-3¢ containing a HpaIsiteandBack6I ... kidney,thymus, liver), and rather weakly in placenta, lung, aorta,amygdala, occipital and parietal lobe and salivary gland.Almost no expression was observed in fetal lung and heart,uterus, bladder, kidney, ... the annealing of the two following synthetic oligonucleotides For EGT 5¢-GATCCGCCACCATGACCATCTTATGTTGGCTCGCTCTCCTGAGCACACTCACAGCTGTTAACGCTGACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCGTTAACAGCTGTGAGTGTGCTCAGGAGAGCGAGCCAACATAAGATGGTCATGGTGGCG-3¢....

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... Mountain View, CA, USA), and poly (A) +RNAwas isolated using Oligo(dT)-Latex Super (Takara ShuzoCo.). cDNA was prepared from mRNA with a Zap-cDNAsynthesis kit (Stratagene, La Jolla, CA, USA) according ... (Shizuoka, Japan), respectively. RNA and DNAmanipulation was generally performed as described previ-ously [9]. Total RNA was extracted from basal tissue of thebarnacle by a Total RNA Separator...

Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

... of automatic evalua-tion methods for generation in terms of adequacy and fluency on automatically generated Englishparaphrases. They find that the automatic metricsare reasonably good at measuring ... nativespeaker judgements on automatically gen-erated German text against automatic eval-uation metrics. We look at a number of metrics from the MT and Summarisationcommunities and find that for a ... of the ACL-IJCNLP 2009 Conference Short Papers, pages 97–100,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLPCorrelating Human and Automatic Evaluation of a German SurfaceRealiserAoife...

Xem thêm