Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

... 2006 FEBS Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa Stefano Grolli, Elisa Merli, Virna Conti, Erika Scaltriti and Roberto ... the 16-h incubations, in which at least 50% of residual lig- and -binding capacity was maintained at the highest [HNE] ⁄ [OBP] values. In the case...
Ngày tải lên : 23/03/2014, 10:20
  • 12
  • 386
  • 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... TLP (5-HIUase) and OHCU decarboxylase] involved in the oxidation of uric acid to allantoin. Certainly, the co-localization of these proteins in the peroxisomes of metazoan and plant species, and the ... on the surface of mucosal epithelial tissues of all animals as part of the innate immune system [47] and is also thought to act as a microbicidal agent in these...
Ngày tải lên : 07/03/2014, 00:20
  • 13
  • 390
  • 0
Báo cáo khoa học: Antioxidant Dps protein from the thermophilic cyanobacterium Thermosynechococcus elongatus An intrinsically stable cage-like structure endowed with enhanced stability potx

Báo cáo khoa học: Antioxidant Dps protein from the thermophilic cyanobacterium Thermosynechococcus elongatus An intrinsically stable cage-like structure endowed with enhanced stability potx

... provided by T. Kaneko, Kazusa DNA Research Institute), using primers Dps-Te1 (5¢-CA AAGGAGACT CATATGAGTGCAACAACTAC-3¢) and Dps-Te2 (5¢-CTACAA AAGCTTAATCCGCAACTAACT GAC-3¢). The NdeI and Hin dIII restriction ... does not warrant the calculation of thermodynamic parameters. DNA -binding ability and DNA protection against hydroxyl radicals Binding of Dps-Te to DNA was analysed in vi...
Ngày tải lên : 16/03/2014, 12:20
  • 16
  • 309
  • 0
Báo cáo khoa học: MAP2 prevents protein aggregation and facilitates reactivation of unfolded enzymes ppt

Báo cáo khoa học: MAP2 prevents protein aggregation and facilitates reactivation of unfolded enzymes ppt

... MAPs are again a mixture of proteins containing predominantly MAP2 and tau with traces of MAP1, MAP4, etc. [33]. We checked the Fig. 1. Insulin and ADH aggregation in the presence of MTP. (A) Aggregation ... segregated acidic amino acids sequence (53–58, 104–107) are found in the N-terminal sequence of tau. In contrast, the N-terminal domain of MAP2 contains about 2...
Ngày tải lên : 23/03/2014, 12:20
  • 9
  • 399
  • 0
Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

... has a large extracellular region, a single transmembrane domain, and a short cytoplasmic tail (except for b 4 ). The N-terminal domains of the a- and b-subunits associate to form the integrin ... findings may explain why bisecting GlcNAc-containing N-glycans are abundant in the brain [65]. In fact, mice carrying an inactive GnT-III mutant have an atypical neurolog- ica...
Ngày tải lên : 18/02/2014, 17:20
  • 10
  • 477
  • 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

... the coiled-coil region of c and the complete a- helical C-terminus as held within the top of (ab) 3 . The rotary axis z was aligned along the main axis of the shaft. The ‘bearing’ included a total of 138 residues ... 2). Molecular dynamics simulations of the rotary mobility of c within the ‘hydrophobic bearing’ at the top of a 3 b 3 The molecular model...
Ngày tải lên : 19/02/2014, 16:20
  • 9
  • 546
  • 0
Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

Tài liệu Báo cáo khoa học: Unfolding and aggregation during the thermal denaturation of streptokinase pptx

... to the sum of a number of two-state transitions. In these fittings the heat capacity change, DC p ,forthe unfolding of each domain was fixed by using the values obtained from the analysis of the ... DC pU were fixed in the fits using the values in Table 1 for SKA at pH 7.0. In addition, for the sake of simplicity the relative heat capacity function of...
Ngày tải lên : 21/02/2014, 03:20
  • 13
  • 503
  • 0
Báo cáo khoa học: Human telomeric G-quadruplex: The current status of telomeric G-quadruplexes as therapeutic targets in human cancer pdf

Báo cáo khoa học: Human telomeric G-quadruplex: The current status of telomeric G-quadruplexes as therapeutic targets in human cancer pdf

... anticancer activity in tumour xenograft models, which indicate that the approach may be applicable to the treatment of a wide range of human cancers. This minireview summarizes the available data on these compounds ... p16 INK 4a kinase and p53 pathways [32–35] which can be visualized by the appearance of charac- teristic DNA damage foci using an antibody to the damage re...
Ngày tải lên : 06/03/2014, 09:22
  • 8
  • 446
  • 1
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

... essential for transformation and may be implicated in retraction of the PilA4-comprising DNA translocator transporting the DNA through the periplasmic space. Binding of the DNA to the DNA -binding protein ComEA ... membrane proteins that probably form part of the assembly platform and are involved in the assembly of the DNA translocator complex in the in...
Ngày tải lên : 07/03/2014, 12:20
  • 12
  • 702
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... pTorA/P2 [ 17] a s a template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site ... specificity for the Tat machinery consisting of the i ntegral membrane proteins TatA/E, TatB and TatC [11]. Little is known about the molecular mechanism of targeting and ex...
Ngày tải lên : 07/03/2014, 16:20
  • 9
  • 393
  • 0

Xem thêm

Từ khóa: