... 2006 FEBS
Odorant binding protein has the biochemical properties
of a scavenger for 4-hydroxy-2-nonenal in mammalian
nasal mucosa
Stefano Grolli, Elisa Merli, Virna Conti, Erika Scaltriti and Roberto ... the
16-h incubations, in which at least 50% of residual lig-
and -binding capacity was maintained at the highest
[HNE] ⁄ [OBP] values. In the case...
... TLP
(5-HIUase) and OHCU decarboxylase] involved in the
oxidation of uric acid to allantoin. Certainly, the
co-localization of these proteins in the peroxisomes of
metazoan and plant species, and the ... on the surface of
mucosal epithelial tissues of all animals as part of the
innate immune system [47] and is also thought to act
as a microbicidal agent in these...
... provided by T. Kaneko, Kazusa
DNA Research Institute), using primers Dps-Te1 (5¢-CA
AAGGAGACT
CATATGAGTGCAACAACTAC-3¢) and
Dps-Te2 (5¢-CTACAA
AAGCTTAATCCGCAACTAACT
GAC-3¢). The NdeI and Hin dIII restriction ... does not warrant the
calculation of thermodynamic parameters.
DNA -binding ability and DNA protection against
hydroxyl radicals
Binding of Dps-Te to DNA was analysed in vi...
... MAPs are again a mixture of
proteins containing predominantly MAP2 and tau with
traces of MAP1, MAP4, etc. [33]. We checked the
Fig. 1. Insulin and ADH aggregation in the presence of MTP. (A)
Aggregation ... segregated acidic amino acids sequence
(53–58, 104–107) are found in the N-terminal sequence of
tau. In contrast, the N-terminal domain of MAP2 contains
about 2...
... has a large extracellular
region, a single transmembrane domain, and a short
cytoplasmic tail (except for b
4
). The N-terminal
domains of the a- and b-subunits associate to form the
integrin ... findings may
explain why bisecting GlcNAc-containing N-glycans
are abundant in the brain [65]. In fact, mice carrying
an inactive GnT-III mutant have an atypical neurolog-
ica...
... the
coiled-coil region of c and the complete a- helical C-terminus
as held within the top of (ab)
3
. The rotary axis z was aligned
along the main axis of the shaft. The ‘bearing’ included a
total of 138 residues ... 2).
Molecular dynamics simulations of the rotary mobility of
c within the ‘hydrophobic bearing’ at the top of a
3
b
3
The molecular model...
... to the sum of a number of two-state transitions. In
these fittings the heat capacity change, DC
p
,forthe
unfolding of each domain was fixed by using the values
obtained from the analysis of the ... DC
pU
were
fixed in the fits using the values in Table 1 for SKA at
pH 7.0. In addition, for the sake of simplicity the relative
heat capacity function of...
... anticancer activity in tumour xenograft models, which indicate
that the approach may be applicable to the treatment of a wide range of
human cancers. This minireview summarizes the available data on these
compounds ... p16
INK 4a
kinase and p53 pathways [32–35]
which can be visualized by the appearance of charac-
teristic DNA damage foci using an antibody to the
damage re...
... essential for transformation and may be implicated in retraction of the
PilA4-comprising DNA translocator transporting the DNA through the periplasmic space. Binding of the DNA to the DNA -binding protein
ComEA ... membrane proteins that probably form part of the assembly platform and are involved in the assembly of the DNA translocator
complex in the in...
... pTorA/P2 [ 17] a s a template and the primers
RRTorA-SacI-fw (5¢-GCGCG
GAGCTCAAGAAGGA
AGAAAAATAATGAAC-3¢, SacI site underlined) and
TorA/Lep2-BamHI-rv (5¢-GCAT
GGATCCCGCGCGC
TTGATGTAATC-3¢, BamHI site ... specificity for the Tat machinery
consisting of the i ntegral membrane proteins TatA/E, TatB
and TatC [11].
Little is known about the molecular mechanism of
targeting and ex...