Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

... Chromatin-binding patterns of Drosophila melanogaster proliferating cell nuclear antigen 2 (DmPCNA2) and DmPCNA1 in response toDNA-damaging agents. (A) Immunoﬂuorescent analysis of the localization ... initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putativepoly (A) addition signal sequence, 5¢-AATAAA [17,18].It encoded a predicted product of 255 amino acidswith a molecular mass of 28.5 kDa, and ... PCNA in Drosophila melanogaster FEBS Journal 273 (2006) 5062–5073 ª 2006 The Authors Journal compilation ª 2006 FEBS 5073 Characterization of a second proliferating cell nuclear antigen (PCNA2)...

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... theabnormal accumulation of intracellular acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application inchemoselective and racemization free deacylation ... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... Coo-massie blue, 2-mercaptoethanol, etc. were purchased from Sigma-Aldrich, St Louis, MO, USA.Bacterial strainThe strain isolated from soil samples was identiﬁed as a bacterium, A. faecalis according...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayﬁsh (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

... spanover a wide range of processes such as transport, cellu-lar uptake and cytoplasmic trafﬁcking of fatty acids,and modulation of the amount of RA available to nuclear receptors [1,20]. FABPs ... J Biochem Cell Biol 36, 2042–2053.15 Kitanaka N, Owada Y, Abdelwahab SA, Iwasa H,Sakagami H, Watanabe M, Spener F & Kondo H(2003) Speciﬁc localization of epidermal-type fatty acidbinding ... FABPs are involved in cellular fatty acidtransport and utilization and compartmentalization of intracellular fatty acid storage, and also in fatty acid-induced regulation of gene expression (for...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-ampliﬁed ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Marchese, S., Brandazza, A. ,Ferrara, L., Pelosi, P. & Scaloni, A. (2001) Bacterial expressionand conformational analysis of a chemosensory protein from Schistocerca gregaria. Eur. J. Biochem....

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... The Authors Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, ... (1997) Anaero-bic metabolism of L-phenylalanine via benzoyl-CoA inthe denitrifying bacterium Thauera aromatica. ArchMicrobiol 168, 310–320.25 Kishore G, Sugumaran M & Vaidyanathan CS (1976)Metabolism ... Steyaert J &Vanderleyden J (2007) Characterization of phenylpyru-vate decarboxylase, involved in auxin production of Azospirillum brasilense . J Bacteriol 189, 7626–7633.20 Asakawa T, Wada...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) Theamino acid sequence of the beta chain of ... importantly, two localmaxima of  330 and 380 nm were also revealed.These maxima are typical of diiron-centre absorbance,and thus characteristic for all haemerythrins [12]. Thisstrongly indicates ... N-terminally or MS-identiﬁed spots.Approximate molecular masses and pI values are indicated to the left and at the top of the gels, respectively. Characterization of prokaryotic haemerythrin O. A. ...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... speciﬁc radioactivity of the125I-labelledPA1b, calculated by the ratio of the radioactivity measuredby gamma counting and the amount of peptide evaluated byabsorbance at 210 nm during HPLC analysis, ... PA1b: ﬁve susceptiblestrains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamaisLS, and S. granarius BrayardÕ and four fully resistantS. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, Cambridge, UK), and plots were drawn using theORIGIN 5 software (Microcal,...

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase puriﬁed from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... APN1AAF08254 HviAAN75693 Har APN1AAF37558 Hpu APN1AAC33301 Bmo Q11001 Mse A pisum APNCAA66467 PxyAAX39864 Tni APN2AAD31184 Ldi APN2BAA32140 Bmo P91885 Mse APN2CAA10950 PxyBAA33715 BmoAAX39866 ... were calculated by ﬁtting data by a weighted linear regression usingthe software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide;...

Xem thêm