0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... Orientale, Alessandria, Italy;3Dipartimento di Biochimica e Biologia Molecolare,Universita`di Parma, ItalyThis paper reports the isolation and characterization of the regulatory moiety of the ... hydroxylase fromAcinetobacter radioresistensS13Isolation and characterization of the regulatory componentErsilia Griva1, Enrica Pessione1, Sara Divari1, Francesca Valetti1, Maria Cavaletto2, ... constants The catalytic activity of PHR was evaluated both in the presence and in the absence of PHI.Km and kcatwere determined from Hanes–Haldane plotfor the two electron acceptors cytochrome c and...
  • 7
  • 514
  • 0
Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

... overall 3900-fold activity compared to the AtSMT cDNA of plant origin. Detailed kinetic analyses of the recombinant protein indicated a random sequential bi-bi mechanism for the SMT-catalyzed transacyla-tion, ... hydrolytic enzymes of primarymetabolism [6,8,15]. Although the analyzed SCPLacyltransferases have maintained the nature and configuration of the Ser-His-Asp catalytic triad fromhydrolases, designed ... carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism Felix Stehle1, Milton T. Stubbs2, Dieter Strack1 and Carsten Milkowski11 Department of Secondary Metabolism,...
  • 13
  • 310
  • 0
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx

Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx

... assayOligonucleotides AS1 5¢-AATATACGTTCGATTAA-3¢ and AS2 3¢-TTATATGCAAGCTAATT-5¢ were synthe-sized by Operon on a 50 nm scale. Annealing of each 5¢-oli-gonucleotide with its complementary 3¢-oligonucleotide at ... allows the formation of macro-lactones instead of the native macrothiolactones. Several thiocoralineanalogs were isolated and investigated for DNA-bisintercalation activity.Relaxed substrate ... investi-gated substrates in graphical form in Fig. S 5A C.DNA-bisintercalation activity assayTo evaluate the DNA-bisintercalative properties of chemoenzymatically generated thiocoraline analogsand...
  • 13
  • 466
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc

... are characterized by a conserved array of 20 cysteines and the absence of His and aromatic amino acids. MT3 contains 68amino acids with 70% sequence identity to the MT1 and MT2 (MT1 ⁄ 2) isoforms. ... is kinetically labile, allowing rapid intra-molecular and intermolecular metal transfer. This is a direct consequence of the relatively high structuraldynamics and flexibility typical of all ... just the result of the larger ionic radius of Cd(II)over Zn(II) and that the difference in amino acidsequence plays a role.One of the most important aspects is the greaterdynamics of the Cd(II)3-CysS9cluster...
  • 10
  • 569
  • 0
Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc

... biomaterials based on layeredsilica, of titania and of zirconia [32]. This view is basedon the finding of a dual role for silicatein as an ana-bolic (silica polymerase) and catabolic enzyme (silicaesterase), ... a Finnigan MAT mass spectrometer 8230 (Midland; Canada).In a control assay, the reaction was performed in the absence of silicatein.Esterase activity The assay is based on the concentration-dependentincrease ... [33,34]; the fractal pat-tern probably dictates the initial shape of the spicules[34]. The finding that silicatein catalyzes two reactions,acting as silica polymerase and silica esterase, providesthis...
  • 9
  • 576
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Using Conditional Random Fields to Extract Contexts and Answers of Questions from Online Forums" docx

... skip-chain edges between any pairs of non-contiguous sentences will be computationallyexpensive, and also introduce noise. To make the cardinality and number of cliques in the graph man-ageable and ... both the union and intersection of the two annotated data. The experimental results onboth data are qualitatively comparable. We only re-port results on union data due to space limitation. The ... is very complicated and too manyparameters need to be learned on our training data.Evaluating Features. We also evaluated the con-tributions of each category of features in Table 3to context...
  • 9
  • 605
  • 0
Báo cáo khoa học: Diện mạo truyện ngắn Hoa Kỳ ba mươi năm đầu thế kỷ 20 potx

Báo cáo khoa học: Diện mạo truyện ngắn Hoa Kỳ ba mươi năm đầu thế kỷ 20 potx

... dfla dng den vdi van hoe va ed nghe dfla dng den canh cifa nha tu- a& apos;y la chan thu quy d ngan hang dia phfldng va la chan chu but sau khi thanh lap td bad hai ra hang tuin la Dd lan vad ... nam trdi qua, anh da cai dflde rfldu va da lai lam an phat dat, anh mud'n cd mot mai a& apos;m gia dinh va Honoria cung mud'n dflde sd'ng cung bd'. Moi chuyen le ra da ... gia cao. vao nhflng nam 1930, Hemingway thUdng den Tay Ban Nha. Nam 1939, sau nhieu nam theo doi va den tham dfl cuoc chien bao ve nen Cdng hda ciia nhan dan Tay Ban Nha, Hemingway da vie't...
  • 12
  • 588
  • 0
Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

Báo cáo Y học: Brassica napus soluble epoxide hydrolase (BNSEH1) Cloning and characterization of the recombinant enzyme expressed in Pichia pastoris docx

... TCC ACC ATG GAT CACCAT CAC CAT CAC ATG GAG CAC CGA AAG TTAAGA GGT AAC GG 3¢) containing five His codons, a BamH1 site, a Kozak consensus sequence for a propertranslation initiation in P. pastoris ... pastoris and also the nine initialbases missing in the isolated cDNA clone. The reverseprimer (5¢ AAG GTA GGA ATT CCT AGA ATT TGGAGA TGA AGT C 3¢) contained an EcoR1 site after the stop codon. The ... mLÆmin)1. The BNSEH1 (60 lg) was loaded at a totalvolume of 500 lL, fractions collected and assayed forenzyme activity and absorbance at 280 nm.Catalytic characterization of recombinant BNSEH1Epoxide...
  • 8
  • 408
  • 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... cannot,however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa-tion properties of the signal at 77 K indicate that the YÆ is coupled to a paramagnetic ... nrdF+gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, NC, USA) ... Brukersoftware, as described above.Analysis of metalsManganese and iron have been determined by GF-AAS and ICP-MS. [As a result of problems with the protein matrix in the analysis of metalloproteins,...
  • 14
  • 872
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ... Ala wascarried out using the QuickChange kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢...
  • 14
  • 601
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI