Báo cáo khoa học: A proﬁle of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

... 128–137 ª 2007 The Authors Journal compilation ª 2007 FEBS 137 A proﬁle of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor Feng ... providefurther speciﬁc ligand- binding information. The ligand- binding data for some mutants, such as W17 6A andL172I, showed an increase that was clearly beyond the standard deviation. The substitutions ... furthermore indicates that the residues Fig. 7. The residues important for the ligand interaction in the eLP2 region of TP. The residues that lost binding activity in the mutagenesis studies are...

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnIsites to produce pTSd. The cDNA fragment ... reported that the alternative splicing of hippostasin is regulated in a cancer-speciﬁc manner [16]. In addition, serum levels of hippostasin are increased in patients with ovarianand prostate cancers ... prosemin was detected as a single band by silver staining (lane 2).(B) After activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated...

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

... of relations that appear in the knowledge base. Thus in the present paper, I investigate the kinds of relations that appear in formal theories of the meanings of the following morphosyntactic ... unacceptable for an application if it is crucial that the inferred intervals contain precisely those values that are warranted by the constraints and the initial labelling. If a superset of ... plexity of the compositional approach may be manageable if certain assumptions about the application domain can be made. TOPIC AREAS: semantics, AI-methods in com- putational linguistics 1 Introduction...

Báo cáo khoa học: Expression proﬁle of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

... PINtrafﬁcking, and provides an additional mechanism for the ﬁne regulation of auxin transport [26]. The para-logs of AUX1, LAX1, LAX2 and LAX3 maintainphyllotactic patterning, and buffer the PIN-mediatedpatterning ... Bootstrap values are presented for all branches. (A) PIN: data on AtPIN and OsPIN families (Tables S3and S4) is based on TAIR annotation and Wang et al. [18]. (B) LAX: Inventory of the AtLAX and ... establishment of embryonic root cell organization in Arabidopsis tha-liana [30]. In addition, AUX1 and LAX3 are involved in auxin–ethylene interactions during apical hookdevelopment in Arabidopsis seedlings...

Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx

... increase the totalprotein extract as starting material in the binding reactionled to a remarkable increase in the background levelscompromising the quality and interpretation of the data. The ... for the wild-type protein (comparelanes 1 and 3). The presence of high molecular massmigrating forms of the mutated protein in the absence of 2-mercaptoethanol indicated that mutation in the ... that these residues are critical for binding.Although there was some variation on protein amount, the mutant recombinant protein and the fusion-truncatedprotein accumulated to similar levels in...

Báo cáo khoa học: A novel, promoter-based, target-speciﬁc assay identiﬁes 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx

... B4GalT6, GM3Sand GAPDH cDNA, the following primers were used: for B4GalT6, the forward primer 5¢-TGAACAGACTGGCACACAACC-3¢ and the reverse primer 5¢-TGTCAGCCCACTTACACCAC-3¢; for GM3S, the forward ... forward primer 5¢-CGTCCCCACAATCGGTGTCA-3¢ and the reverse primer5¢-ACCACTCCCTCTTTGACCAG-3¢; for GAPDH, the forward primer 5¢-CCACCCATGGCAAATTCCATGGCA-3¢ and the reverse primer 5¢-TCTAGACGGCAGGTCAGGTCCACC-3¢. ... synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4(NeuAca2,3)LacCer;...

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... mitochon-drial respiratory chain. Biochem J 386, 255–261.9 Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C(2005) Transactivation of the EGF receptor and a PI3kinase-ATF-1 pathway is involved in ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-agishi M, Taira K & Yabe-Nishimura C (2005) Essen-tial role of ATF-1 in induction of NOX1, a catalyticsubunit of NADPH oxidase: involvement of mitochon-drial ... mRNA. Accordingly, the 5¢-ﬂanking region of exon 1c appears to contain ele-ments essential for the speciﬁc expression of the NOX1mRNA in dedifferentiated VSMC. In the aorta or in a vascular...

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... direct interaction with theirmembranes.Materials and methodsMaterialsAll chemicals were of the purest analytical grade available.Proteases, aprotinin, lysozyme, and a- casein were fromSigma-Aldrich. ... and to other extracellular matrix proteins that are not protease inhibitors but containKazal-like motifs. The closest relatives of PSKP-1 are serineprotease inhibitors, and a few examples are ... heparin.Certain basic proteins have ancillary antibacterial activ-ity. Some examples are aprotinin, SLPI, and CAP18 [39,40].All seem to interact with bacterial membranes, although the molecular basis of...

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Committee.Acetylcholine, atropine, concanavalin A, CCK-8 andCCK-8-NS were obtained from Sigma-Aldrich. Alamar bluewas obtained from Astral Scientiﬁc (Caringbar, New SouthWales, Australia).Guinea pigs weighing approximately ... Bioscience, The University of Queensland, Brisbane, Queensland, AustraliaMarsupials are born in an immature state and many of the developmental processes that occur in thesemammals take place during ... cleavages) are fragmentations of amide moieties, and give infor-mation analogous to that provided by B and Y+2cleavages in the corresponding positive ion spectra. The other backbone cleavages...

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... which the subtrees are speciﬁed in advance, in an adaptor grammar the subtrees, aswell as their probabilities, are learnt from the train-ing data. In order to make parsing and inferencetractable ... repeatedly drawing a ball at random from the urn and then returning itplus an additional ball of the same color to the urn. In an adaptor grammar there is one DP for eachadapted nonterminal A ... seeJohnson et al. (2007b). Formally, an adaptor gram-mar is a PCFG in which a subset M of the nonter-minals are adapted. An adaptor grammar generates the same set of trees as the CFG with the same rules,but...

Xem thêm