0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

... of Bacillus anthracis FEBS Journal 275 (2008) 6237–6247 ª 2008 The Authors Journal compilation ª 2008 FEBS 6247 Identification, characterization and activation mechanism of a tyrosine kinase of ... as Walker A, A and B,with some exceptions [4]. The majority of the bacterial tyrosine kinases possess a transmembrane domain and an intracellular catalytic domain [3,4]. These twodomains are ... proteins also lack tyrosine kinase activity. However, the blast search of McsB and its activator McsA in the B. anthracis databaserevealed two orthologs, BAS0080 (81% similarity) and BAS0079 (69%...
  • 11
  • 407
  • 0
Báo cáo khoa học: Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot

Báo cáo khoa học: Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot

... I-D-AEA-K R-DD-QNTIVK-VGATAASASA 122 A Active siteR101BNRI/MHvTrxh1HvTrxh2Ta a Os a OsbTdTabTacTadHv a ScLpHbOscCKN A ZmOseOsdLcPcAtaAtbAtcAtdAteAtfAtgBnaBoBnbBraBrbPmFeCmNtaPtAthAtiRcNtbNtcPpPsaPsbPscPsd*Fig. ... purifiedprotein was missing methionine and alanine from theN-terminus. This was confirmed by the N-terminalsequences of HvTrxh2, determined to be AASATAAAVA and ASATAAAVAA. Multiple peaks were observed ... foramplification of the HvTrx2 coding sequence as above. A second PCR with Pfu DNA polymerase and primers trxh1(TTCATATGGCGGCGTCGGCAACGGCG) and trxh2(GGGGATCCTGAGCGGCAATTTTATTTAGGCG)was used...
  • 11
  • 435
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe amplification for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... sequenced RpCAtr (BPNJ¼ 100 and BPMP¼ 99). Fungia scutaria (FCA -a and FCA-b) and Caenorhabditis elegans (CA1 and CA2) sequences falloutside of clade I and are more closely related to eachother...
  • 14
  • 591
  • 0
Báo cáo khoa học: Purification, characterization and molecular cloning of tyrosinase from the cephalopod mollusk, Illex argentinus docx

Báo cáo khoa học: Purification, characterization and molecular cloning of tyrosinase from the cephalopod mollusk, Illex argentinus docx

... proenzyme of phenol oxidase A 1 of Drosophila melanogaster. Proc. Natl Acad.Sci. USA 92, 7769–7773.13. Kawabata, T., Yasuhara, Y., Ochiai, M., Matsuura, S. & Ashida,M. (1995) Molecular cloning of ... bp of the 5¢untranslated regions and the 3¢ untranslated regionscontaining polyadenylation signals (AATAAA) at threepositions and the poly (A) -tails. The criteria for a consensustranslation ... limpet (a marine gastropod, Megathura crenulata)as an immunotherapeutic agent for the treatment of bladdercarcinoma [27], and other observations suggesting thatCorrespondence to T. Naraoka, Aomori...
  • 13
  • 342
  • 0
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt

Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt

... CATCGTCATGTTTGAACCRTWF5. 1a/ 3¢ PFIKPR a CCTGGGTTTAATAAATGGActin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGACActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a Primer based on complement.Table 2. Properties of ... estimate the net charge K and R were assumed to have a value of + 1, H of + 1/2, D and E of )1, and C-terminal amidation was counted as an additional +1.Label Residues Amino acid sequence MrChargeWF1-like a 24 ... SFDDNP a GGGTTGTCATCGAATGAGWFX RTWFX RSTEDI CGTTCTACAGAGGACATCRTWFX/3¢ DDDDSP a GGGGCTGTCATCATCATCWFY (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACCRTWF5.1/3¢ GYLNAA a GGCCGCATTGAGATAACCWFZ (Y1)...
  • 11
  • 415
  • 0
Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

... C-terminal arginine,was designed as follows (Fig. 3A) . Two overlappingoligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCAAGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAGCAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAGCTTCCTCACGGACCAGTTCACGTTCGTCCGCTGCCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACGGCAAGTGCATGAACCGGAAGTGCAAGTGCTACCCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGCCTTCACGTTCACGATGGGCACTCCTAG-5¢,respect-ively, ... 5¢-GAGGTCGACATGCGCTGCAAGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAGCAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAGCTTCCTCACGGACCAGTTCACGTTCGTCCGCTGCCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACGGCAAGTGCATGAACCGGAAGTGCAAGTGCTACCCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGCCTTCACGTTCACGATGGGCACTCCTAG-5¢,respect-ively, ranging in ... vector-related fragments. In a parallelexperiment with AgTx2, chromatographic profiles of rAgTx2 and commercially available rAgTx2 (AlomoneLaboratories) under the same conditions were comparedand...
  • 12
  • 502
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 ... CGAGCAGGAGATGGGAACC Real-time PCRZfbactin-R CAACGGAAACGCTCATTGC Real-time PCRZfgapdh-F CGCTGGCATCTCCCTCAA Real-time PCRZfgapdh-R TCAGCAACACGATGGCTGTAG Real-time PCRZFil4-F CATCCAGAGTGTGAATGGGA ... CTGCTTTTCTGGGGACTTCA Initial PCRZf3¢foxp3-F1 TGAAGTCCCCAGAAAAGCAG 3¢-RACEZf3¢foxp3-F2 GTGCTTTGTGCGTGTTGAAG 3¢-RACEZf5¢foxp3-R1 TGTATGATGGAAAAGGTGGCA 5¢-RACEZf5¢foxp3-R2 GGAACACACAGAGGGGATGATA 5¢-RACEOligo...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato S, Imamura ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate humanparasite Schistosoma ... day and 35 day para-sites, adult worm pairs, separated adult female and male worms, and eggs. cDNA from uninfected B. glabrata snails served as a neg-ative control.J. M. Carlo et al. SmSmad1B,...
  • 19
  • 653
  • 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGTCATGACCTCG-3¢. One strand of each oligonucleotide ... bp wasproduced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAACAAACACAC-3¢, reverse primer: 5¢-AAGATGGTATTGAAGATGATGGTTGA-3¢), purified from agarose ... Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with32P using a Metaprime kit (Amer-sham Pharmacia Biotech Inc., Piscataway, NJ, USA). ForBAC DNA sequencing, the BAC clone was...
  • 16
  • 542
  • 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... 25–29.12 Kawakami R, Sakuraba H, Kamohara S, Goda S,Kawarabayasi Y & Ohshima T (2004) Oxidative stressresponse in an anaerobic hyperthermophilic archaeon:presence of a functional peroxiredoxin ... the first of all Prxs analysedso far in archaea that has only one cysteine residue inthe sequence.Transcriptional analysis of bcp2 under oxidativestress and characterization of mRNA 5¢ endIn ... Garrett RA (2005) Diver-gent transcriptional and translational signals inArchaea. Environ Microbiol 7, 47–54.17 Bell SD (2005) Archaeal transcriptional regulation – vari-ation on a bacterial theme?...
  • 11
  • 565
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật