Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... detect cross-linking enzyme activity in the skin Yoshiaki Sugimura 1, *, Masayo Hosono 1, *, Miyako Kitamura 1 , Tatsuya Tsuda2, KiyofumiYamanishi2, Masatoshi Maki 1 and Kiyotaka Hitomi 1 1 Department ... cen-trifugation at 10 000 g for 15 min at 4 °C. The precipitatewas dissolved and radioactivity was determined using a scintillation counter.Evaluation of synthetic peptides as a substrate The 12 -amino-acid ... indicated that the cross-linking reaction was catalyzed specifically byTGase 1. To further evaluate the specificity of the assay for TGase 1, skin sections from a TGase 1 knockout mouse were also examined....
- 11
- 449
- 1
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... 615 –6 31. 14 Facchiano A & Facchiano F (2009) Transglutaminasesand their substrates in biology and human diseases:50 years of growing. Amino Acids 36, 59 9– 614 . 15 Sugimura Y, Hosono M, Wada ... Kitamura M & Sugimura Y (2009) Preferred substrate sequences for transglutaminase 2: screeningusing a phage-displayed peptide library. Amino Acids36, 619 –6 24. 19 Akiyama M, Sakai K, Yanagi ... Cystatin M ⁄ Eisahigh affinity inhibitor of cathepsin V and the shortchain form of cathepsin L by a reactive site that isdistinct from the legumain-binding site. A novel clue for the role of...
- 11
- 645
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... characteristics of protein arginine methyltransferase 1 and 3 toward the Ewing sarcoma protein and a peptide. Proteins 61, 16 4 17 5.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin F, ... oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain that isrequired for the oncogenic ... 2 011 The Authors Journal compilation ª 2 011 FEBS Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding proteinKentaro Takahama 1, *, Katsuhito Kino2,*, Shigeki Arai3,...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipperdomain and fork-head domain of foxp3. In addition, for stat6 and foxp3,...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc
... Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect Immun 66, 18 91 18 97. 51 Caroff M, Tacken A & ... (19 93) A major outermembrane protein of Moraxella catarrhalis is a target for antibodies that enhance pulmonary clearance of the pathogen in an animal model. Infect Immun 61, 200 3–2 010 .47 Wang ... the CCRC.References 1 Catlin BW (19 90) Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,29 3–3 20.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis:...
- 14
- 674
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... parasite.SmSmad1B demonstrates sequence motifs that arecommon to R-Smads, such as a nuclear localizationsignal and a DNA-binding domain in the MH1 domainand the L3 loop, and the C-terminal, ... CA, USA). To test for protein interactions, the SmS-mad1B-pGADT7 plasmid that encodes for SmSmad1B fusedwith the Gal4 activation domain (Gal4AD) was cotrans-formed with the Gal4 DNA-binding ... Nucleic Acids Res 28,42 91 4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato S, Imamura T &Miyazono K (2004) Regulation of transforming growthfactor-beta and...
- 19
- 653
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613 –6 30RpCAbrR1 CGT AGC AGT ATC AGC AGT 82 2–8 39RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616 –6 34RpCAtrRprobe TAA GAT TAC CAG AAT TGC 84 4–8 61 a Primers designed ... TAC AAG GAT GCC ATT AGC 613 –6 30RpCAbrR1 CGT AGC AGT ATC AGC AGT 82 2–8 39RpCAbrR2 AGA GCA GCA GAC CTT ACG 70 6–7 23RpCAbrR3 GTT ACT TCC GCA GCT AGG 46 6–4 83Probe amplification for FISHRpCAbrF TAC ... zinc-containing enzymes catalyzing the reversible hydration of CO2to bicarbonate. Ubiqui-tous in a wide range of eukaryotic organisms, they arealso widespread in the Archaea and Bacteria domains [11 ]....
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein ... protein 12 A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor ... GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer in B cells, kinasecomplex-associated proteinAAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine...
- 11
- 570
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... & Nagasawa H (2007) The structure–functionrelationship analysis of Prismalin 14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 515 8– 516 6.9 Murayama ... 2523 Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otolithsHidekazu Tohse 1, 2, Yasuaki Takagi2and Hiromichi Nagasawa 1 1 Department of Applied ... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of thisprotein, we revealed that the aggregate also contains the inner ear-specific collagen otolin -1 [9].ResultsCloning...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx
... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... 12 -b-hydroxylase from cell cultures of Digitalis lanata. FEBS Lett 18 8, 11 14 .26 Hayashi H, Hanaoka S, Tanaka S, Fukui H & TabataM (19 93) Glycyrrhetinic acid 24-hydroxylase activity in microsomes of ... functionalexpression assayMasaaki Shibuya 1 , Masaki Hoshino 1 , Yuji Katsube 1 , Hiroaki Hayashi2, Tetsuo Kushiro 1 , andYutaka Ebizuka 1 1 Graduate School of Pharmaceutical Sciences, The University...
- 12
- 704
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ