Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

... accuaaagcauuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca;ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcugacccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa;PKCa #2, gccuccauuugauggugaagaugaa; ... gccuccauuugauggugaagaugaa; PKCd #1, ccacuacaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugcaucgacaa. PKCe #1, PKCe #2 and PKC siRNAs are the‘validated Stealth RNAi duo pak’ from Invitrogen (CergyPontoise, ... 2009)doi:10.1111/j.1742-4658.2009.06899.x Extracellular signal-related kinase (ERK) is a well-known kinase takingpart in a signal transduction cascade in response to extracellular stimuli.ERK is generally viewed as a kinase that is...

Báo cáo khoa học: Puriﬁcation and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

... vectorThe human PKIb coding region was ampliﬁed by PCR witholigonucleotides 5¢-CCCCATATGATGAGGACAGATTCATCAAAAATG-3¢ and 5¢-CATGGATCCTCATTTTTCTTCATTTTGAGGC-3¢. The ampliﬁed PCR fragmentwas inserted ... England Biolabs.DEAE Sepharose Fast Flow exchange media were obtainedfrom Amersham Pharmacia Biotech Company.Isolation and sequencing of a cDNA clone encodinghuman PKIb A high quality cDNA ... contains an open reading frame of 237 nucleotidesand a putative polyadenylation signal ATTAAA (1018–1023) and poly (A) tail (Fig. 1). The human PKIb protein predicted by the open reading frame is...

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exempliﬁed by a novel neuronal protein, CASK-interactive protein1 pot

... such as Abi2. [We havealso found an in vivo association and colocalization ofAbi2 with Caskin1 (A. Balazs, V. Csizmok, P. Tompa,R. Udupa & L. Buday, unpublished results).]Caskin1 is a scaffold ... Ste5 scaffold allos-terically modulates signaling output of the yeast mating pathway. Science 311, 822–826.19 Mark WY, Liao JC, Lu Y, Ayed A, Laister R, Szymc-zyna B, Chakrabartty A & Arrowsmith ... minimum at202 nm (Fig. 2A) , which is characteristic of a protein in a largely disordered conformation. The CD spectraof the separate PRDs also show characteristic minimaaround 200 nm (Fig. 3A) ,...

Báo cáo khoa học: Acidic extracellular pH increases calcium inﬂux-triggered phospholipase D activity along with acidic sphingomyelinase activation to induce matrix metalloproteinase-9 expression in mouse metastatic melanoma pot

... phospholipase D(PLD)–mitogen-activated protein kinase (MAPK) [extracellular signal regulated kinase (ERK)1 ⁄ 2 andp38] pathway, at least in part through acidic pHesigna-ling through nuclear factor-jB ... Ka¨ha¨ri VM (1998) Enhance-ment of ﬁbroblast collagenase (matrix metalloprotei-nase-1) gene expression by ceramide is mediated by extracellular signal -regulated and stress-activated protein kinase ... thereby maintaining protein kinase B activation and Bcl-XL levels. J BiolChem 278, 24399–24408.36 Denys A, Aires V, Hichami A & Khan NA (2004)Thapsigargin-stimulated MAP kinase phosphorylationvia...

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... enzymes were used to separate individualdomains: D1, MfeI and XhoI; D2, XhoI and AatII; D3,AatII and AvrII. PCR using Ex Taq HS polymerase (Taka-ra USA, Santa Ana, CA, USA) was performed to ﬁll ... Fig. 1).Based on the above comparisons, it appears that allthree FlgCK domains have the requisite elements forcatalysis and are at least capable of the same types ofstructural interactions ... Biophysics, Florida State University, Tallahassee, FL, USACreatine kinase (CK) plays a central role in energyhomeostasis in cells that display high or variable ratesof ATP utilization, such as neurons,...

Báo cáo khoa học: Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase doc

... phos-phorylate all natural substrates and a wide range ofmedically important NAs with outstanding efﬁciency,as shown in Table 1 [5–9]. This makes it a very prom-ising candidate as a suicide ... inthis battle is gene therapy, where a suicide gene is introduced into a malignant cell followed by the addi-tion of a NA speciﬁcally activated by the enzymeencoded by this gene. The activated ... turnover rate and a wide substrate rangethat makes it a very good candidate for gene therapy. This concept is basedon introducing a suicide gene into malignant cells in order to activate a prodrug...

Báo cáo khoa học: Identiﬁcation, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx

... MS, Fabiola F, Gattis JL, Somasundaram T &Chapman MS (2002) Reﬁnement of the arginine kinase transition-state analogue complex at 1.2 A resolution,mechanistic insights. Acta Crystallogr ... 625–634.38 Nieba L, Nieba-Axmann SE, Persson A, Ha¨ma¨la¨inenM, Edebratt F, Hansson A, Lidholm J, MagnussonK, Karlsson AF & Plu¨ckthun A (1997) BIACOREanalysis of histidine-tagged proteins ... the kinase activity of the catalytic domain [4].McsB is a unique tyrosine kinase of Bacillus subtilisthat contains a eukaryotic-like guanidino-phospho-transferase domain for its kinase activity....

Báo cáo khoa học: D1 – Extracellular Matrix Proteins docx

... Molecular Dentistry, Okayama UniversityGraduate School of Medicine and Dentistry, Okayama, OkayamaJapan,2Biodental Research Center, Okayama University DentalSchool, Okayama, Okayama Japan.E-mail: ... inmacrophages via activation of thetranscription factor PU.1T. Alissaﬁ1, C. Tsatsanis1, A. Androulidaki1, I. Charalampopou-los2, E. Dermitzaki1, A. Gravanis2and A. Margioris11Laboratory ... of human ADAare known: small and large isoforms of isoenzyme ADA1 and iso-enzyme ADA2. ADA1 and ADA2 differ in kinetic and immuno-chemical properties and probably are coded by separate geneticlocus....

Báo cáo khoa học: Identiﬁcation and functional characterization of an aggregation domain in long myosin light chain kinase ppt

... 87,2157–2161.32 Noguchi J, Yanagisawa M, Imamura M, Kasuya Y,Sakurai T, Tanaka T & Masaki T (1992) Completeprimary structure and tissue expression of chicken pec-toralis M -protein. J Biol Chem ... DA (1990) Isolation and char-acterization of a cDNA clone encoding avian skeletalmuscle C -protein: an intracellular member of the immu-noglobulin superfamily. Proc Natl Acad Sci USA 87,2157–2161.32 ... endothelial cells. Cardiovasc Res 44, 623–631.13 Szaszi K, Kurashima K, Kapus A, Paulsen A, KaibuchiK, Grinstein S & Orlowski J (2000) RhoA and rho kinase regulate the epithelial Na+ ⁄ H+ exchangerNHE3....

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... Horse-radish peroxidase-conjugated antibody against caspase-3(#610325) was from BD Pharmigen, and antibody againstb-actin (A5 441) was from Sigma.Statistical analysisAll data are expressed as ... inhibit thapsigargin-inducedCtrl3 h12 h24 h 36 h6 hOAOASA/OASA/OASA/OASA/OASA/OASAOAFL1-LogCountsOAOASASASASACtrlCtrlCtrlCtrlCtrlSA OA SA/OA A BFig. 5. Stearate (SA) supplementation ... unsaturated FFAs into the cells. After theirinternalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS. Fatty acyl-CoAs are acti-vated forms of fatty acids that can...

Xem thêm