Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... significant inhibitory and promotional effectson amylin aggregation. In the SEC analysis (Fig. 6),the peak of insulin supernatant almost disappearedafter 48 h of incubation, suggesting that amylin insulin complexes ... various caseins during their fibrillation. Alto-gether, these results indicate that insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation, and insulin can eventually promote ... believed that insulin serves as an impor-tant biological factor that inhibits amylin aggregation [10,11]. Early studies claimed that insulin might act as a natural inhibitor under normal circumstances...
- 7
- 388
- 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx
... GGATCCTTTAAGCGGCAAGCAA), AtGPX2 (CATATGGCGGATGAATCTCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5(CATATGGGTGCTTCATCATCAT ⁄ GG ATCCCTGTGCGTGTTCACAA) and AtGPX6 (CATATGGC AGCAGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA)without ... GGATCCAGTTATCCAGATTGAA)without transit peptides or Trx h2 (CATATGGGAGGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA)and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCCAAATCAAGCAGCAGC) proteins were amplified by RT-PCR ... thioredoxin-specificglutathione peroxidase isoenzymes of Arabidopsis thalianaAqib Iqbal1, Yukinori Yabuta2, Toru Takeda2, Yoshihisa Nakano1and Shigeru Shigeoka21 Department of Applied Biological Chemistry,...
- 9
- 414
- 0
Báo cáo khoa học: "Blog Categorization Exploiting Domain Dictionary and Dynamically Estimated Domains of Unknown Words" potx
... Dictionary andDynamically Estimated Domains of Unknown WordsChikara HashimotoGraduate School of Science and EngineeringYamagata UniversityYonezawa-shi, Yamagata, 992-8510, Japanch@yz.yamagata-u.ac.jpSadao ... Japanch@yz.yamagata-u.ac.jpSadao KurohashiGraduate School of InformaticsKyoto UniversitySakyo-ku, Kyoto, 606-8501, Japankuro@i.kyoto-u.ac.jpAbstractThis paper presents an approach to text cate-gorization that ... that appear frequently in the Web.They represent the contents of domains.2 Associating JFWs with Domains A JFW is associated with a domain of the highest A dscore.An A dscore of domain is...
- 4
- 278
- 0
Báo cáo khoa học: "Self-Organizing Markov Models and Their Application to Part-of-Speech Tagging" potx
... structure.This paper presents a way of utilizing statisticaldecision trees to systematically raise the memorycapacity of Markov models and effectively to makeMarkov models be able to accommodate various ... performances. For ex-ample, we often find that in some cases a certainlexical context can improve the performance of anHMM-based POS tagger, but incorporating such ad-ditional features is not easy ... models. Wall Street Jour-nal as contained in Penn Treebank II is used as thereference material. As the experimental task is part- of- speech tagging, all other annotations like syntac-tic bracketing...
- 7
- 400
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA ... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses of nitrite appearance and disappearance ... biogenesis suggests that the activity of NirF cannot be similar to that of Met8P activitywhere a comparable mutation is inhibitory. A puzzle is that some NirF sequences, notably for two strainsof...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... that bacitracinshould not be regarded as a specific inhibitor of PDI.ResultsBacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDIPDI is a catalyst of ... point.Table 1. Analysis of the aggregation rate during rhodanese refold-ing at pH 7.2. The rate of aggregation relative to the negative con-trol in the absence of bacitracin is presented as mean ... DsbC,as well as the isolated catalytic a domain of PDI. Boththe PDI a domain and DsbA have a catalytic site, withan associated substrate-binding site, but lack an inde-pendent substrate-binding...
- 9
- 620
- 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt
... human intestinalepithelial cells (Caco-2). Cell 60, 429–437.5 Misumi Y, Hayashi Y, Arakawa F & Ikehara Y (1992)Molecular cloning and sequence analysis of humandipeptidyl peptidase IV, a ... Allison JP, Chesner JE, Leger MJ, RidgeLL & Walborg EF Jr (1983) Characterization of a family of glycoproteins associated with the bile canalicu-lar membrane of normal hepatocytes but not ... after SDS ⁄ PAGE and subjected to proteolysis and MALDI-TOF analysis. Data were analysed usingMASCOT; accession numbers for eachscored protein in the NCBI nonredundant databank are listed; Sequence...
- 12
- 738
- 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45 kDa (Fig. 1A) [15].The predicted molecular mass of Lpx1p is 44 kDa.It carries a peroxisomal ... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar hydrolases ... preparations in triplicate. Candida rugosa lipase (CRL) was usedas a positive control for lipase measurement. (Pancreas) lipaseactivity assays used DGR in a coupled enzyme assay as a sub-strate....
- 11
- 568
- 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... The absorbance was determined at 492 nm withplate reader (Sunrise, Tecan, Gr¨odig, Austria).Data analysisData were analyzed by Student’s t-test. A value of P < 0.05 was considered statistical ... reactionvolume with rTaq DNA polymerase or LA TaqTMDNApolymerase with GC buffer (TaKaRa). Human NANOGP8mRNA was amplified by RT-PCR using total RNAsextracted from urinary bladder cancer tissue. ... NANOGP86050403020100MockMockNANOGP8NANOGP81.8 A B1.61.41.210.80.60.40.20day 1day 2 day 3 day 4% AbsorbanceS stage percentageFig. 6. FACS analysis results. FACS analysis of cells transfectedwith NANOGP8 and...
- 8
- 495
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... plasmid pUG27 [13] using the primersdisSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, ... S.pombehis5+construct amplified from plasmid pUG27 asdescribed above using the primers disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. ... chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and disRAS2revCorrespondence to M. Ru¨tzler, Department of Biological...
- 8
- 485
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ