Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... lab worksimage acquisition and analysis software was used to quan-tify band intensities. Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are ... LA,Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Lab-ourier E et al. (2006) The colorectal microRNAome.Proc Natl Acad Sci USA 103, 3687–3692.14 Yanaihara N, Caplen N, Bowman E, Seike M, Kumam-oto ... comple-mentary; therefore, they function through translationalrepression rather than cleavage [5]. On the basis of this, miRNAs could control as many as 30% of allprotein-coding genes [6]. MicroRNAs...
- 11
- 396
- 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... chromosomalDNA of M. mazei as template and the following primers:mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAAATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev,5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCATTTTTTGC-3¢. The ... A molecular mass of 20 kDa was found by SDS ⁄ PAGE, consistent with the expected mass of 19.2 kDa of the protein monomer(not shown). The native enzyme had a molecular mass of 19 kDa when analyzed ... structure of a monofunctional catalase fromMethanosarcina barkeri. Arch Microbiol 171, 317–323.39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK &Shima S (2000) Protection of Methanosarcina barkeriagainst...
- 10
- 539
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... 3353 Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin Divya Kapoor1, Balvinder ... plasmid. The gene was amplified from this plasmid by PCR using for-ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAATCATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-TATACTATCCTCGAGCCACTGCATATCACGGATACGACGC-3¢. ... Gambeta.We amplified the cDNA for cB using forward primer5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTTACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGATAAAAATCCATCACCCG-3¢, and digested this withrestriction...
- 13
- 430
- 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... (GEHealthcare, Anapolis, MD, USA) to the ICU but not on the gen-eral wards. The new system was introduced following a pro-gram of staff training and HWP was completely changed on a single day. The ... investigator illness. The ICU medical and nurs-ing staff were unaware that the study was being conducted.Ethical approval was not sought, because at the time auditswere not within the remit of the ... the results. Pharmacist attendance atward rounds has been associated with a reduction in adverseevents [15]. In this study the pharmacist attended the wardround throughout the study. No other...
- 6
- 526
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... demonstrated that Asp129 of NirFcould not be essential for any function similar to thatin Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealingbecause of the presence of a putative ... d1heme lacking iron and ⁄ or with the side chain satu-rated, but accessing these putative substrates is nottrivial. An alternative approach would be to seek accu-mulation of the substrate of NirF ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... that the occluding loop is rather flexible and willadapt to structural features of the inhibitors as well asto the packing constraints of the environment. The lar-ger and wider the features of ... demonstrate that the occluding loop residues can adopt a variety of con-formations, whereas the rest of the structure of cathep-sin B appears to be rigid. A comparison of the interaction constants...
- 8
- 632
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... Petersburg,FL, USA) followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned ... 275,10995–11001.40 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ(1995) A potential catalytic site revealed by the 1.7-Angstrom crystal structure of the amino-terminal sig-nalling domain of Sonic ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated...
- 14
- 499
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1family, is expressed during inflammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K. Ray11 Department of Veterinary ... the functional significance of SAF-3, wecompared its transactivation potential with that of SAF-1. The SAF-3 expression plasmid transactivatedexpression of the SAF-3X-CAT reporter at a muchhigher...
- 11
- 439
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... (S1278b) the kanMX cassette from plasmidpUG6 [12] was amplified by polymerase chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and ... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present in the plasmid ... 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, respectively. YEp351-SUT2was linearized with SphI and co-transformed with the yEGFP...
- 8
- 485
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... for mouse Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols ... 14220–14225.18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H,Sato S & Kawakami K (1999) Cooperation of Six andEya in activation of their target genes through nucleartranslocation of Eya. Mol Cell ... plot analysis of the microarray datashowed that most of the data points fell along the diagonal, indicating that most of the genes wereequally expressed in the two samples (supplementaryFig....
- 16
- 476
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ