Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
... levels
during the differentiation of fetal adipose tissues and
with the maturation of human primary adipocytes,
suggesting that CIDEC might be a target of PPARc
transactivation. These data suggest that ... Authors Journal compilation ª 2010 FEBS 4183
Cell death-inducing DFF45-like effector, a lipid
droplet-associated protein, might be involved in...
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc
... sec-
tions incubated with preadsorbed primary antiserum
(Fig. 6B). The brown 3,3¢-diaminobenzidine (DAB)
staining was granular and confined to the cytoplasm
of the cells. Based on their size and shape the ... epithelial cells and
vascular endothelial cells. These data suggest an important role for Cyp4x1
in the brain.
Abbreviations
DAB, 3,3¢-diaminobenzidine; TCDD, 2,3,7,8 tetrac...
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx
... 1 Plasmid constructs are derivatives of pDA3480 [9,10]. The 5¢ end of the transcript is 5¢-AAUUGUGAGCGGAUAACAAUUUCA-
CCAGGUAAUAAAUU
AAAUAAAAUUUAAAUAUG-3¢ for the gene variants that lack a functional ... expression in
the cases of the arginine codons CGG and AGG, such
effect is not observed for the other analysed arginine
codons AGA, CGC, CGA and CGU. The amino acid
seq...
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... interactor.
Nucleolin was first described as a major nuclear pro-
tein consisting of a negatively charged N-terminal
domain, an RNA-binding domain and a C-terminal
domain rich in RGG motifs [54]. Nucleolin has been
reported ... sig-
nal. The low yields of the AP probe and of nucleolin,
together with the inevitable partial degradation of
nucleolin, mean that calculations...
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx
... Yokogawa
T, Okuni T, Nakayama H, Takio K, Yabuki T, Kigawa
T, Kodama K, Yokogawa T, Nishikawa K &
Yokoyama S (2002) An unnatural base pair for incor-
porating amino acid analogs into proteins. ... incorporation of unnatural amino acids, have
taken advantage of advances in cell- free translation
systems. The use of tRNA, mischarged with an un-
natural amino acid through a chem...
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... CCTTTGAGCACATTTCGGCAA-3¢
P450 aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 289
5¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢
b-actin 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ 665
5¢-3222 AGCCATGCCAAATGTCTCAT-3¢
Fig. 1. Dose-related ... CT, USA).
DNA quanti®cation
The DNA content of the cell layer at the end of incubation
was quanti®ed by the method of West et al .[31].After
solubilization of the...
Báo cáo khoa học: Cell biology, regulation and inhibition of b-secretase (BACE-1) potx
... 1743–1752.
36 Harada H, Tamaoka A, Ishii K, Shoji S, Kametaka S,
Kametani F, Saito Y & Murayama S (2006) Beta-site
APP cleaving enzyme 1 (BACE1) is increased in
remaining neurons in Alzheimer’s disease ... diagram of the alternative processing pathways of APP. The transmembrane
APP undergoes two alternative and competing pathways of metabolism. The major and non-amyloidog...
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt
... GCTTTGTTCGTGCAAATTTCC 55 35
CTGCAAATATCTCTGGGAAGA
TRPC5 CAGCATTGCGTTCTGTGAAAC 55 35
CAGAGCTATCGATGAGCCTAAC
TRPC6 GACATCTTCAAGTTCATGGTCATA 55 35
ATCAGCGTCATCCTCAATTTC
TRPC7 CAGAAGATCGAGGACATCAGC 55 ... (5¢-to3¢)
Annealing
T (°C)
Cycle
number
Actin TGTTGGCGTACAGGTCTTTGC 60 23
GCTACGAGCTGCCTGACGG
GAPDH TATCGTGGAAGGACTCATGACC 55 20
TACATGGCAACTGTGAGGGG
TSP1 CCGGCGTGAAGTGTACTAGCTA 65 25
TGCACTTGGC...
Báo cáo khoa học: Cell-free protein synthesis ppt
... are
translated by a complex mixture that contains ribo-
somes and a full complement of initiation, elongation
and termination factors, as well as a full set of amino-
acyl-tRNA synthetases and other required ... other applications. In the E. coli
system programmed with plasmid DNA, the cell
extract contains or is supplemented with an RNA po-
lymerase to transcribe the gene...
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
... protein was
subcellularly located mainly in the Golgi apparatus and at the plasma
membrane. Pulse–chase metabolic cell labelling studies revealed that GFP–
PrP
C
was initially synthesized as a 45-kDa ... 402–409.
57 Beggah A, Mathews P, Beguin P & Geering K (1996)
Degradation and endoplasmic reticulum retention of
unassembled alpha- and beta-subunits of Na,K–ATPase
correlat...
Từ khóa:
- báo cáo khoa học
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật