Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

... The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity Zhengfeng Zhang1,2, Ruoyang Shi1, ... Bcl-2 family, including Bad, Bax, Bid,and Bim, permeabilize mitochondrial membranes [ 13] . Bcl-2 ⁄ E1B-19K-interacting protein 3 (BNIP3) is a member of a unique subfamily of death- inducing mito-chondrial ... anti-body against BNIP3 was ﬁrst incubated with a BNIP3–GST protein. (F) Quantiﬁcation of the western blot bands revealed a nine-foldincrease of BNIP3 in KA-injected striatum.There was a 3. 5-fold increase...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_0011 136 53 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS ... that there is an alternative isomerase in the retina of cone-dominantspecies, likely in retinal Mu¨ller cells [33 ,34 ]. In the present study, we report the clon ing and characterization of a ... Immunostaining of zebraﬁsh retinal sectionusing antibodies for GS and RPE65c.Fig. S3. Hypothesized molecular mechanisms of the in vitro assay system and the intra-retinal visual cycle.This supplementary...

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... antagoniz-ing cell shrinkage may be a general feature of apoptosis. For example, renal tubular epithelial cellapoptosis was accompanied by a caspase-dependentcleavage of the Na+⁄ H+exchanger ... phosphorylation of CD95 onTyr 232 and Tyr291 by the EGF-receptor tyrosinekinase activity [15]. Although the appearance of CD95at the plasma membrane was associated with death inducing signaling complex ... microdomains of the plasmamembrane (caveolae), intracellular organelles, ligand-independent activation of growth factor- and cytokinereceptors and autocrine stimulation of signal transduc-tion...

Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc

... with a functional blocking antibody to b1. These ﬁndings mayexplain why bisecting GlcNAc-containing N-glycansare abundant in the brain [65]. In fact, mice carryingan inactive GnT-III mutant ... (1997)Isolation, characterization and inactivation of the mouse Mgat3 gene: the bisecting N-acetylglucosamine in asparagine-linked oligosaccharides appears dispens-able for viability and reproduction. ... 281, 38 3 43 38 350.68 Luo BH, Springer TA & Takagi J (20 03) Stabilizing the open conformation of the integrin headpiece with a glycan wedge increases afﬁnity for ligand. Proc NatlAcad Sci USA...

Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modiﬁcations ppt

... monitoring of acute and chronic in ammation in mammalian brain tissue both in vitro and in vivo,including in the detection of cerebral malaria.Retooling of this reporter system also allowed ... versatility and general applica-tion to modiﬁed protein (glycoprotein) synthesis.Chemical strategies in glycoproteinsynthesis The chemical attachment of glycans offers an alterna-tive, pragmatic ... Tamm–Hors-fall protein, which carries two glycans, and the intro-duction of two glycans onto a galactosidase (lacZ)reporter protein. In all cases, the proteins maintainednative function as well as being...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive chargeon the stator attracts ... F1F0ATP syntheses.This low H+(Na+) ⁄ ATP ratio is apparently the reasonfor the inability of eukaryal V1V0ATPases to catalyzeATP synthesis in vivo [11,12]. On the other hand, thislow ... nFDlNaþwhere n is the number of translocated ions and F is the Faraday constant. The c subunit of the eukaryal V1V0ATPases present in organelles arose by duplication and fusion of the bacterial c subunit,...

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... concentration. Our new identiﬁcation of the majordihydroxyvitamin D3 product as 20, 23- dihydroxyvitamin D3, rather than20,22-dihydroxyvitamin D3, explains why there is no cleavage of the vita-min ... action of P450scc, as well as the products that they gave rise to.This revealed both the major and minor pathways for the metabolism of vitamin D3 by P450scc.ResultsMetabolism of vitamin D3 by ... 500-MHz NMR spectra of 1 7a, 20, 23- tri-hydroxyvitamin D3.This material is available as part of the online articlefrom http :// www.blackwell-synergy.comPlease note: Blackwell Publishing are not responsiblefor...

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebraﬁsh pptx

... othermembers of the TGF-b family, binding to and inhibit-ing these signaling molecules from binding to theirreceptors in the extracellular space, thus inhibiting ven-tralizing activities. Of these proteins, ... Chordin along the dorsoventralaxis.Other aspects of BMP signaling, besides dorsoventralpatterning, are reported. BMP signaling is involved in endodermal patterning, and this is also regulated ... transcripts are found in the organizer of gastrula embryos, later in the prechordal plate andaxial mesoderm (Fig. 2). By contrast, noggin2 tran-scripts are detected at the end of gastrulation in the axial...

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... FEBSand alkali extraction might not always be a reliableindicator of whether a protein is integral in the outermembrane [17,20–22].As a distinct means to separate integral and peri-pheral ... that while most of the protein components are integral in the membrane, most of these mitochondrial pro-teins behave as if they have a- helical transmembrane domains, rather thanb-barrels. These ... residues and a high abundance of aromatic residues that tend to be placed at the start of the strands [2,5]. These b-barrel proteinsare assembled in the bacterial outer membrane in a process mediated...

Tài liệu Báo cáo khoa học: "An Experiment in Evaluating the Quality of Translations" pdf

... it is not every machine that is re- ferred to as an automatic machine I 8.67 1 .33 10.00 4 .33 II 9.00 1 .33 10 .33 5 .33 5. Machine: However, by far not every machine is called automatic machine ... Translation No. 5: a machine translation (Machine Program A) Translation No. 7: a machine translation (Machine Program B, 2d Pass) Translation No. 9: a machine translation (Machine Program ... relative to the translation. In this way, the translation is being evaluated—not the original—since the judg- ments of the informativeness of the original are to be made only after the translation...

Xem thêm