0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

Báo cáo khoa học: Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics pdf

... 5¢-ACTCAAATCACTAGTATTCTTCCACCA-3¢and 5¢-CATTTGAACATAAACATGAACAAATAAGTT-3¢and the following conditions: annealing temperature 55 °C,25 cycles, Phusion polymerase used according to themanufacturer’s ... activity of the latex of Vasconcel-lea heilbornii and the identification of a putative homologous lipase from Carica papaya. Triacylglycerol lipase activity was enriched 74-fold from crude latex ... Authors Journal compilation ª 2010 FEBS Identification of a putative triacylglycerol lipase from papaya latex by functional proteomics R. Dhouib1, J. Laroche-Traineau2, R. Shaha1, D. Lapaillerie3,...
  • 14
  • 395
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... structure–functionrelationship analysis of Prismalin–14 from the prismaticlayer of the Japanese pearl oyster, Pinctada fucata.FEBS J 274, 5158–5166.9 Murayama E, Takagi Y, Ohira T, Davis JG, GreeneMI & Nagasawa H ... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... by invertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals...
  • 12
  • 568
  • 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined by MS. A range of molecular masses was found for the core oligosaccharideconsistent with a composition ... equimolar ratios.O-Deacylated LPS (LPS-OH) from all strains wasprepared by hydrazinolysis, and initial analyses werecarried out by negative-ion ESI-MS and CE-ESI-MS(Table 1). MS-MS enabled ... equimolar ratios. Sugar analysis of theLPS-derived alditol acetates from the galE mutant of strain 1000 revealed glucitol, glucosaminitol andL-gly-cero-D-manno-heptitol in approximately...
  • 8
  • 361
  • 1
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... werepurchased from Sigma.DNA manipulation and sequence analysisPlasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performed by the standard methods ... 811–819.28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979)An improved assay for nanomole amounts of inorganic phos-phate. Anal. Biochem. 100, 95–97.29. Farahbakhsh, Z.T., Huang, ... 11718–11728.27. Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi,K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of theLonproteasegenefromThermus thermophilus HB8 and char-acterization of...
  • 11
  • 505
  • 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– ... TAATACGACTCACTATAGGGAGACCACAACGGTTTCC1– GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG2+ GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG 2a+ GACTGCAaCCCCAAAtCGGACAG2b+ CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC2– ... GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC3+wtGGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC3+YIRNGGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG3– GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGGÓ FEBS 2003 A novel CaM-binding site found in ammodytoxin A (Eur. J. Biochem. 270) 3019Vista, CA), digested with BamHI/HindIII...
  • 8
  • 401
  • 0
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... (5¢-AATAGAGAATTCAGAGAAAGAGATACGAGATGGA-3¢) andU660033Not (5¢-TCATAAGGCGGCCGCCTACATCGATCTTAATCTGCTCAA-3¢). A fragment carryingAt3g21260 cDNA was amplifed from A. thaliana RNA by RT-PCR. RNA was isolated from ... (5¢-AGACTGCTCTAGAATGGGTTTCTAAACCAACACGT-3¢) and GLTP1PRON-BAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAAGGTGGG-3¢). A 1.3 kb fragment carrying the At1g21360promoter was amplified using primers 21360PRUXBA(5¢-AACGATCTAGATTAAGAATGTAATCACATTAGGGT-3¢) ... modelingenvironment.Histochemical GUS activity assays A 1.8 kb DNA fragment carrying the At2g33470 promoterwas amplified from the A. thaliana Col-0 genome usingprimers GLTP1PROUXBA (5¢-AGACTGCTCTAGAATGGGTTTCTAAACCAACACGT-3¢)...
  • 17
  • 300
  • 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... GGCAACGAGCAAGGTCCGAAGmopE–R 2589 R AAGTCGTTGCAATCGGCGTCGsapE–F 2590 F GGCAACGAGCAAGGTCCGAAGsapE–R 2590 R GACGTCGTGAGTGCCTCCGTGmopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGGmopB–R 3103 R AGTATCAAACCGTGCTGGTCTCCHeme ... would lead to a mature protein of 732 amino acids with a theoreticalmolecular mass of 78 kDa. A search in the PROSITEdatabase of protein families and domains [12] withMCA2590 revealed two ... HarborLaboratory, Cold Spring Harbor, NY.33 Altschul SF, Madden TL, Schaffer AA, Zhang J, ZhangZ, Miller W & Lipman DJ (1997) Gapped BLAST andPSI-BLAST: a new generation of protein databasesearch...
  • 12
  • 392
  • 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt

... for angiotensin II receptor (AT 1a) cDNAcloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward);5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse).Primers used for cannabinoid receptor-1 (CB-1) cDNAcloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢;5¢-TGCCCCCTGTGGGTCACTTTCT-3¢.Plasmids ... expression pattern,cellular localization and functions of RGS5s suggest that RGS5s may play a critical role in the regulation of intracellular signaling pathways.AbbreviationsAT1, angiotensin ... Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissuesYanbin Liang, Chen Li, Victor M. Guzman, William W. Chang, Albert J. Evinger III, Dyna Saoand David...
  • 9
  • 312
  • 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

... Department of Bioscience and Bioinformatics, Kyushu Institute of Technology, Iizuka, Fukuoka, Japan2 Department of Biological Sciences, Faculty of Science, Kanagawa University, Hiratsuka, Kanagawa, JapanAlthough ... purification and partial characterization of a putative microtubule-associated protein (MAP) from bovine adrenal cor-tex with an approximate molecular mass of 250 kDa. The protein wasexpressed ubiquitously ... bovine adrenal gland ferritin; andlanes 3 and 6, the 250 kDa protein. Identification of a putative MAP as ferritin M. R. Hasan et al.824 FEBS Journal 272 (2005) 822–831 ª 2005 FEBSabsorbance data...
  • 10
  • 232
  • 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

... Dissociation andreassociation was analysed by SDS ⁄ PAGE. Two micrograms of pro-tein were loaded on each lane and the gel was stained with silver.M, Bio-Rad11broad molecular mass standard (Bio-Rad ... served as template for the amplifi-cation of the oad-1 and oad-2 genes by PCR [21]. For theexpression of oadA-2 with an N- or C-terminal His tagoadA-2 was amplified from pET24-VcoadGAB-2 harbour-ing ... specific decarboxylation reaction into anelectrochemical gradient of Na+ions which plays a profound role in the energy metabolism of these bac-teria [4].Oxaloacetate decarboxylase is a membrane-boundenzyme...
  • 10
  • 333
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ