Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) wereampliﬁed. ... acid metabolism underanaerobic conditions is expected to result in equalamounts of formate and acetyl-CoA and the resultingacetyl-CoA is then metabolized into equal amount of ethanol and acetate...

Báo cáo " Study, Design and Manufacture Microstrip Antenna For Advance Mobile Handsets " potx

... this antenna is chosen because it has advantages by its characteristics such as easier to design and manufacture than the PIFA antennas. Thank to simple structure and omni-directional radiation, ... Information and Communications Strategy, 115 Tran Duy Hung, Hanoi, Vietnam Received 19 March 2010 Abstract. This paper concentrates on studying, designing and manufacturing a dual – band and ... substrate is used to reduce the size of a monopole antenna. But the resulted antenna was mainly applicable for single-band operation. To achieve dual-band operation in a compact monopole antenna...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... Vandekerckhove J, Van Montagu M,Zabeau M & Boerjan W (2001) Partial puriﬁcation and identiﬁcation of GDP-mannose 3¢,5¢-epimerase of Ara-bidopsis thaliana, a key enzyme of the plant vitamin ... University of Brussels, BelgiumVitamin C (l-ascorbic acid; L-AA) is an importantmetabolite of plants and animals. It functions as anantioxidant (or pro-oxidant), an enzyme cofactor, aneffector of ... respectively, as a direct electron acceptor. The animal and plant l-gul-onolactone oxidoreductases are also active towards thel-galactono-1,4-lactone substrate.Only scarce data are available on...

Báo cáo khoa học: Mutagenesis at the a–b interface impairs the cleavage of the dystroglycan precursor doc

... italic:S55 6A forward: 5¢-TGGGTTCAGTTTAACGCCAACAGCCAGCTCATG-3¢S55 6A reverse: 5¢-CATGAGCTGGCTGTTGGCGTTAAACTGAACCCA-3¢Q55 9A forward: 5¢-TTTAACAGCAACAGCGCGCTCATGTATGGCCTG-3¢Q55 9A reverse: 5¢-CAGGCCATACATGAGCGCGCTGTTGCTGTTAAA-3¢M56 1A ... 5¢-CACATGGCTGCTGTCAGCCAGGCCATACATGAG-3¢S65 4A forward: 5¢-CAGAACATCACTCGGGGCGCTATCGTGGTGGAATGGACC-3¢S65 4A reverse: 5¢-GGTCCATTCCACCACGATAGCGCCCCGAGTGATGTTCTG-3¢G563AP56 5A forward:5¢-AGCCAGCTCATGTATGCCCTGGCTGACAGCAGC-3¢G563AP56 5A ... 5¢-CAGGCCATACATGAGCGCGCTGTTGCTGTTAAA-3¢M56 1A forward: 5¢-AGCAACAGCCAGCTCGCGTATGGCCTGCCTGAC-3¢M56 1A reverse: 5¢-GTCAGGCAGGCCATACGCGAGCTGGCTGTTGCT-3¢Y56 2A forward: 5¢-AACAGCCAGCTCATGGCTGGCCTGCCTGACAGC-3¢Y562A...

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ... gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg...

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative ability/neg. ... exophoric anaphoric exophoric anaphoric anaphoric anaphoric exophoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric...

Tài liệu Báo cáo " Research on optimal silicon etching condition in TMAH solution and application for MEMS structure fabrication " ppt

... 12. Fabrication procedure of MEMS piezoresistive accelerometer using TMAH. Silicon wafer: standard cleaning Pattern aligner marks Etching for aligner marks Pattern etch window from back ... influence of temperature on surface roughness. The etch-rate increases strongly with increasing temperature. The fit curve has a shape of an exponential curve. The small deviation of experimental ... important quantities determining the etched surface quality in MEMS fabrications. 3. Results and discussion The Figs 2 and 3 show the results on the influence of temperature on etch rate and...

Tài liệu Báo cáo khoa học: Application of a ﬂuorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Free ligandswere adsorbed on charcoal, and the absorbance spectrawere recorded. Concentration of appearing IF–CNCbl wascalculated by comparison with the standards IF–H2OCbl and IF–CNCbl according ... and ﬁxation of the ligands by IF. Dissociation of IF–CBC was biphasic, and existence of multiple protein–analogue complexes with normal and partiallycorrupted structure may explain this behaviour. ... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005)...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence ... chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of  81 000 A ˚2with 30% ( 24 000 A ˚2) as con-tact area. ... Gly-Gly-Cyssequence was introduced at the C-terminus using oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21cells were transformed...

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-GTGTTTCAGGGCTTCTCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthasesubunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢-TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCCACCCTACTAAACC-3¢ ... 5¢-TAACCCCACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGATTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCACC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢.Western blotCells were rinsed in NaCl ⁄ Pi, trypsinized and collected ... normalized to b-globin.The sequences of the primers used in this study were as fol-lows: ERRa:5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGGTTGACCCTGTTCCT-3¢ and...

Xem thêm

Từ khóa: design and fabrication of pedal powered laundry washing machine design and fabrication of pedal powered washing machine the design and development of a solar powered refrigerator aspects of research design and program evaluation the design and implementation of public works programs a toolkit for practitioners design and implementation of a computer based inventory control system for a pharmaceutical store design and construction of a synchronous generator test setup design and development of a product selection design and simulation of a drive system báo cáo của tạp chí department of mathematic báo cáo của tạp chí journal of operator theory báo cáo tài chính ngân hàng đông á phân tích báo cáo tài chính ngân hàng đông á research design and implementation báo cáo thực tập về ngân hàng á châu Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP