0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

... sequence MethodR74I 5¢-CCCGTCCCCACCATGATCCGCGGCTTCACCGGG-3¢ USER74Q 5¢-CCCGTCCCCACCATGCAGCGCGGCTTCACCGGG-3¢ USER75I 5¢-CCCGTCCCCACCATGCGCATCGGCTTCACCGGG-3¢ USER75Q 5¢-CCCGTCCCCACCATGCGCCAGGGCTTCACCGGG-3¢ ... 5¢-CCCGTCCCCACCATGCGCCAGGGCTTCACCGGG-3¢ USER160Q 5¢-TAGCGGAACTGCAGCAGCG-3¢ KunkelR162A 5¢-CGCTGCTGCGGTTCGCATACTTCCCGCAGGTC-3¢ PCRR162Q 5¢-CGCTGCTGCGGTTCCAATACTTCCCGCAGGTC-3¢ PCRR266I 5¢-AGTGTGTTCTTCCTCATCCCCAACGCGGACTTC-3¢ ... Taiwan;3Department of Pharmacy and Pharmacology, The University of Bath, UK Deacetoxycephalosporin C synthase (DAOCS) catalyses the oxidative ring expansion of penicillin N, the committed step in the biosynthesis...
  • 5
  • 462
  • 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... only in the case of cathepsin B binding. The contribution of the second binding loop of cystatin A to protease binding varies with the protease, being largest,  45% of the total binding energy, ... ForwardGCTCAGGCGACCATGGGCCATCATCATCReverse CTTGCATGCCCTGCAGGTCGMutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse ... of Leu73 and Pro74 jointly contribute  45% of the totalunitary free energy of binding of cystatin A to cathepsin B,demonstrating a major role of the second binding loop of cystatin A in the inhibition...
  • 10
  • 533
  • 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf

... substrate binding residues bP22(CB) and bF24(CE2), respectively.Changing the acyl binding site by mutagenesis may in uence the synthetic capacities of PA in different ways. The relative affinity of the ... of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, the NetherlandsPenicillin acylase of Escherichia coli catalyses the hydrolysis and synthesis ... 5¢-ATAAGTATACGCAGGCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATCACACCATTATGACCAAAAACCAGCCCGGGATAGGC-3¢. The underlined codons code for bF24 and bF57 and were changed to ATA, CCA,...
  • 8
  • 561
  • 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

... efficiently by ligation to zinc indicatingthat some aspects of the zinc ligand environment are sur-prisingly uncritical for coenzyme M binding. Keywords:11zinc enzymes; methanogenic archaea; methyltransferases; ... absence and presence of coen-zyme M, indicate how zinc interacts with its substrate coenzyme M and how zinc is most probably coordinated in the active site of this methyltransferase.Upon binding ... using the mutagenicprimers 5Â-CCGTGACTGTACTCgcCATCTGTGGTAAGG-3Â (sense) and 5Â-CCTTACCACAGATGgcGAGTACAGTCACGG-3Â (antisense); in the second mutant, Cys239was exchanged for Ala using the primers...
  • 7
  • 464
  • 0
Báo cáo y học:

Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

... specifically investigated the epidemiology of sodium disturbances in the intensive careunit (ICU). The objectives of this study were to describe the incidence of ICU-acquired hyponatraemia and hypernatraemia and ... cardiopulmo-nary resuscitation (CPR), comfort care). Severity of illness atinception (within the first day of ICU admission) was assessedusing the APACHE II score and intensity of care using the TISS score ... patients and hypernatraemia in 2157(26%) patients with an incidence density of 3.1 and 7.4 per 100days of ICU admission, respectively, during 29,142 ICUadmission days. The incidence of both ICU-acquiredhyponatraemia...
  • 8
  • 721
  • 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... that the cytosolic RNase inhibitor (cRI) plays a major role in determining the ability of an RNase to be cytotoxic. However, to interact with cRI RNasesmust reach the cytosol, and cross intracellular ... displays cytotoxic activity on eukary-otic and bacterial cells [32].Given the recently reported cytotoxic activity of the noncovalent dimers of RNase A [17], intriguing whencompared to their ... resist-ance to the cytosolic RNase inhibitor.RNase catalytic activity is an absolute requirementfor the cytotoxic action of all cytotoxic RNases tested[5]. Moreover, when the effects of cytotoxic...
  • 11
  • 643
  • 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... GAT1 In order to gain further insight into the role of the terminal structures of the N-glycans of GAT1, N-gly-cosylation processing of NNN was inhibited by 1-de-oxymannojirimycin (dMM). Inhibition ... modification may in uencemany of the physicochemical and biological proper-ties of the proteins, such as protein folding, stability,targeting, dynamics and ligand binding, as well ascell-matrix ... and DDN contain only oneN-glycosylation site, deficiency of terminal trimming of their N-oligosaccharides strongly affected their GABA-uptake activity. These indicate that the terminalstructure...
  • 14
  • 654
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Role of Information Retrieval in Answering Complex Questions" ppt

... fu-ture of QA research. Other types of complex needsinclude analytical questions such as “How close isIran to acquiring nuclear weapons?”, which are the focus of the AQUAINT program in the U.S., and opinion ... Previously, they were the focus of a small pilot study within the AQUAINTprogram, which resulted in an understanding of a“relationship” as the ability for one object to in- fluence another. Objects in ... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 523–530,Sydney, July 2006. c 2006 Association for Computational Linguistics The Role of Information Retrieval in Answering...
  • 8
  • 442
  • 0
Báo cáo Y học: The folding of dimeric cytoplasmic malate dehydrogenase Equilibrium and kinetic studies doc

Báo cáo Y học: The folding of dimeric cytoplasmic malate dehydrogenase Equilibrium and kinetic studies doc

... unfolding and refolding of s-MDH usingactivity assay, fluorescence, far-UV and near-UV circulardichroism (CD) spectroscopy, hydrophobic probe-1-anilino-8-napthalene sulfonic acid binding, dynamic ... When incubated with increasingconcentrations of GdnHCl there is a decline in the far-UVCD signals reflecting the gradual loss of the secondarystructure of the protein. Figure 3B shows the change ... 8. The kinetics of reassociation and folding of s-MDH at 25 C as determined from the chemical-cross linking reactions with the nonspeci c cross-linking reagent glutaraldehyde. The enzyme concentration...
  • 11
  • 399
  • 0
Báo cáo Y học: The expression of glutathione reductase in the male reproductive system of rats supports the enzymatic basis of glutathione function in spermatogenesis doc

Báo cáo Y học: The expression of glutathione reductase in the male reproductive system of rats supports the enzymatic basis of glutathione function in spermatogenesis doc

... novosynthesis from b uilding blocks, glutamate, cysteine, and glycine, via two ATP-con suming s teps involving c- g lut-amylcysteine synthetase ( cGCS) and glutathione synthetase. The other constitutes ... intensity of the bandsfor the protein and the mRNA were faint.Effects of inhibitors of cGCS and GRon primary cultured testicular cellsTo investigate t he contribution of de novo synthesis and the recycling ... but contains no cysteine. Protamine, which isreplaced for hitstone via transit proteins during spermio-genesis, is rich in both arginine and cysteine. The cysteinesulfhydryls in protamine...
  • 9
  • 494
  • 0

Xem thêm

Từ khóa: the role of capital market in industrial growth and development in nigeriathe role of capital market in economic growth and development of nigeriathe role of capital market in economic growth and developmentthe role of oxidative stress in female reproduction and pregnancythe role of oxidative stress in diabetic vascular and neural diseasethe role of remote sensing in deciphering functional and structural diversitythe role of veterinary pharmacovigilance in risk analysis and the influence of risk perception on veterinary pharmacovigilancebáo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenwhat is the role of positive feedback in the endocrine systemthe role of positive feedback in homeostasisNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ