Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf

... deterministic, al- ways returning a single value. Moreover, default specifications can be made to act as indefeasible information, using YADU's DefFill operation (Las- carides and Copestake, ... subcat- egorisation information. The issue of how to organise lexical information is especially important when a lexicalised for- malism like Categorial Grammar (CG) or Head- Driven Phrase ... paper we demonstrate that using default unification, namely the order-independent and persistent version of default unification de- scribed in (Lascarides et al, 1996b) and (Las- carides and...

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... instructions, containingends compatible with the expression vector (forwardprimer, 5¢-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCRproduct ... chitinolyticmachineries, such as in the lactic acid bacterium(LAB) Lactococcus lactis ssp lactis IL1403. LABs areGram-positive, facultatively, anaerobic, fermentativebacteria that are of major importance ... the data to theMichaelis–Menten equation by nonlinear regression using graphpad prism (GraphPad Software Inc., San Diego, CA,USA).The speciﬁc activity of LlChi1 8A towards a natural sub-strate...

Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

... approach, the stability potential of the parD system was compared with that of the ccd system of plasmid F, as well as that of the parDETA system of plasmid RK2 ⁄ RP4 and hok-sok of plas-mid ... MazF and MazE in a hexamer that comprises two dimers of MazF and a dimer of the MazE antitoxin arranged linearly(MazF2–MazE2–MazF2). This work provided the ﬁrststructural image of an antitoxin ... two of the threeR1 auxiliary maintenance locus: parA and parB(Fig. 1A) [14]. The combined action of both systemsincreases the stability of the plasmid by four orders of magnitude. parA, a partitioning...

Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf

... representation of the interpretation of logical metonymyand a more thorough evaluation methodthan that of Lapata and Lascarides (2003).By carrying out a human experiment weprove that such a representation ... byLapata and Lascarides (2003) used text corpora toautomatically derive interpretations of metonymicphrases.1Utiyama et al. (2000) used a statistical modelfor the interpretation of general ... withtheir log-probabilities are shown in Table 2.4.2 Comparison with the Results of Lapataand LascaridesWe compared the output of our reimplementation of Lapata and Lascarides’ algorithm with...

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... discourse marker for those lexical items that (in addition to non -lexical means such as punctua- tion, aspectual and focus shifts, etc.) can sig- nal the presence of a relation at the linguistic ... be able to derive the discourse relations holding between adjacent text spans, and also to notice the additional semantic and pragmatic implications stemming from the usage of a particular...

Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx

... recognize any given instance of the concept Canada constitutes our concept of Canada. According to a second view, Kant considers a concept as an abstract representation (vorstellung) of the ... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An outline of a theory ... (concepts as rules and concepts as a structural representation). We have based our analysis on Kant's distinction in order to separate clearly between the organization of the inferences and...

Báo cáo khoa học: The A domain of ﬁbronectin-binding protein B of Staphylococcus aureus contains a novel ﬁbronectin binding site pdf

... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRIFnBPB(–142–480)R AATGGATCCTTACTTTAGTTTATCTTTGCCG BamHIFnBPB(388–980)F CCCAAGCTTGATGATGTCAGC Hind ... CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF...

Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx

... et al. (2005). The re-search established that even a small amount of ad-ditional training data can give a substantial im-provement in question analysis in terms of bothCFG parse accuracy and ... from appropri-ate treebank material. However, treebank- andmachine learning-based grammatical resources re-flect the characteristics of the training data. Theygenerally underperform on test data ... for a given language or task.Large treebanks are available for major languages,however these are often based on a specific texttype or genre, e.g. financial newspaper text (thePenn-II Treebank...

Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot

... cysteine proteasespapain, cathepsin L and cathepsin V using benzyloxycar-bonyl (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) assubstrate, and for legumain with Z-Ala-Ala-Asn-AMC asthe substrate, while ... pooled,concentrated by ultraﬁltration (Amicon UM-10; Millipore,Vienna, Austria) and dialyzed against 0.02 m Tris–HCl, pH7.5. The sample was then applied to a column of DEAE–Sephacel (Pharmacia-LKB, Uppsala, ... Nucleic Acids Res 36, D190–D195.13 Altschul SF, Madden TL, Schaffer AA, Zhang J, ZhangZ, Miller W & Lipman DJ (1997) Gapped BLAST andPSI-BLAST: a new generation of protein databasesearch...

Báo cáo khoa học: "Generating a Table-of-Contents" pptx

... Table -of- ContentsS.R.K. Branavan, Pawan Deshpande and Regina BarzilayMassachusetts Institute of Technology{branavan, pawand, regina}@csail.mit.eduAbstractThis paper presents a method for the auto-matic ... Most of these approaches are tailored to a par-1The code and feature vector data forour model and the baselines are available athttp://people.csail.mit.edu/branavan/code/toc.ticular domain, ... hierarchical discriminativeapproach for table -of- contents generation. Figure 1shows a fragment of a table -of- contents automat-ically generated by this algorithm. Our methodhas two important points...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin BT Tieng anh 6 UNIT 2 Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam