Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx
Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx
... controversial answers. Weintroduce adaptivity in QA and IR by cre-ating a hybrid system based on a dialogue interface and a user model. Keywords: question answering, information retrieval, user modelling, ... Adaptivity in Question Answering with User Modelling and a Dialogue InterfaceSilvia Quarteroni and Suresh ManandharDepartment of Computer ScienceUniversity of YorkYork YO10 5DDUK{silvia,suresh}@cs.york.ac.ukAbstractMost ... where age and browsing history, respectively, are part of the UM. In this paper we focus on how to filter and adaptsearch results using the reading level parameter.3 Dialogue interfaceThe dialogue...
- 4
- 292
- 0
Tài liệu Báo cáo khoa học: "The QuALiM Question Answering Demo: Supplementing Answers with Paragraphs drawn from Wikipedia" ppt
... shown, and in this paragraphone sentence containing the answer is highlighted.Note also, that each paragraph contains a link thattakes the user to the Wikipedia article, should he/shewant to ... reasons:1. QuALiM is an open domain Question Answer-ing system and Wikipedia is an “open domain”Encyclopedia; it aims to cover all areas of inter-est as long as they are of some general interest.2. ... Wikipedia paragraph which contains additional information of potential interest to the user is dis-played. In this paragraph the sentence containing the answer is highlighted. This display of...
- 4
- 477
- 0
Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc
... the Scandinavian countries linked by rail?". In cases involving aggregate operators such as "total" and "average", an indexed set is clearly needed, and Chat handles ... general programs as well as to databases. Current Prolog systems, because they were designed with programming not databases in mind, are not capable of accommodating really large databases. ... technical obstacle to building a Prolog system that is fully comparable with current relational database management systems, while retaining Prolog's generality and efficiency as a programming...
- 4
- 445
- 0
Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx
... and western blotting. The horizontal line indicates the samples with added rBAX. Membranes were incubated againstanti-BAX mAb, stripped, and evaluated for VDAC content to check protein loading. ... to alkalineextraction before SDS ⁄ PAGE fractioning and western blotting. Membranes were incubated against anti-BAX mAb, stripped, and evaluatedfor VDAC content to check loading. Blots are ... previous treatment (trace a) . Mitochondria incubated with rBAX without calcium (trace b). Mitochondria incubated with rBAX and calcium (trace c). A ab, crBAXBAXMβCD–– + A BVDAC00.040.060.080.100.125001000...
- 11
- 447
- 0
Báo cáo khoa học: Changes in microRNAs associated with hepatic stellate cell activation status identify signaling pathways docx
... (Pierce), and antibody against actin (Santa Cruz, CA, USA) (1 : 500) asan internal standard.Statistical analysisAll of the results are expressed as mean ±standard devia-tion. Statistical analysis ... comparative bioinformatics analysis of micro-arrays of quiescent and activated HSCs. Changes in miRNAs associated with HSC activation status revealed that 13 pathways were upregulated and 22 pathways ... Kanematsu M, Semelka RC, Osada S & Amaoka N(2005) Magnetic resonance imaging and expression ofvascular endothelial growth factor in hepatocellularnodules in cirrhosis and hepatocellular...
- 14
- 478
- 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
... 5¢-TTCTTAACCATGGGCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAAGGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢;BCCPD67, 5¢-GTAACCATGGGTGAACAGGAAGA A- 3¢;BCCP-rev,5¢-GGATCCTTAAACGTTTGTGTCTATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTGGTTATGAAC-3¢.DNA was isolated from agarose using a ... details are as follows (restriction sitesare indicated by underlining and mutagenic changes areshown in bold). BPL-for, 5¢-TTCTTAACCATGGGCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAAGGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢;BCCPD67, ... for DNAbinding; a central catalytic domain, which contains a highlyconserved GRGRRG motif shown to be involved in biotinbinding [11]; and a small C-terminal domain which has beenpostulated...
- 11
- 578
- 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx
... antisenseYH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern blot analysis probe, for 18S rRNAYH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNAH. Yang et al. Gua–RPL4 interaction ... human Gua and FLAG-tagged human RPL4 deletion mutant shown in (D) were immunoprecipitated using anti-FLAG resin and blotted as indicated.H. Yang et al. Gua–RPL4 interaction in mammalian rRNA productionFEBS ... cotransfected with FLAG-tagged RPL4 and protein A- tagged Gua were immunoprecipitated with anti-FLAG resin and probed with indicated antibodies. (F) HeLacells transfected with FLAG-tagged human...
- 15
- 433
- 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... data (different from the trainingdata)1.RerankingCandidate 1Candidate 2Candidate 3Candidate 4: Case element: VerbCandidateCandidateFigure 2: Selection of possible parses for rerankingMany ... using a Japanese depen-dency analyzer such as KNP (Kurohashi and Na-gao, 1994) or CaboCha (Kudo and Matsumoto,2002). Although this information is less accu-rate than manually annotated information, ... verb/nounsuffix. By defining a bunsetsu in this manner, wecan analyze a sentence in a way similar to that usedwhen analyzing the grammatical roles of words in inflected languages like German.Japanese dependencies...
- 8
- 481
- 0
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... inductive learning algorithm for learningclassification tasks. Memory-based learning treats a set of labeled (pre-classified) training instancesas points in a multi-dimensional feature space, and stores ... types of input. Second, there are indications thatincreasing the training set of language processingtasks produces much larger performance gains thanvarying among algorithms at fixed training set ... worsethan with attenuated words only). Our function tag-ging task is easier thanfindinggrammaticalrelationsas we tag a headword of a chunk as e.g. a subject in isolation whereas grammatical relation...
- 8
- 657
- 0
Báo cáo khoa học: "Natural Language Generation as Planning Under Uncertainty for Spoken Dialogue Systems" pptx
... supervisedlearning of dialogue policies from fixed datasets.Computational Linguistics (to appear).Srinivasan Janarthanam and Oliver Lemon. 2008. User simulations for online adaptation and knowledge-alignment ... knowledge-alignment in Troubleshooting dialogue systems. In Proc. of SEMdial.Alexander Koller and Ronald Petrick. 2008. Experi-ences with planning for natural language generation. In ICAPS.Alexander Koller and ... Prasad. 2007. Individual and domain adap-tation in sentence planning for dialogue. Journal ofArtificial Intelligence Research (JAIR), 30:413–456.Steve Whittaker, Marilyn Walker, and Johanna Moore.2002....
- 9
- 300
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP