Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot
Báo cáo khoa học: "Toward a Redefinition of Yea/No Questions" pot
... any set of referents {bl, ,bn} that can be partially ordered by a relation O s can support scalar implicature. Any scale S that permits scalar implicature can be represented as a partiallg-ordered ... as b~,th members of a set of Hawaiian cities, he can affirm an unqueried set member (ltilo) to deny a queried member {llawaii). The affirmati,~n of an unqueried ah,'rnate value generally ... the affirmation or denial of more than one scalar h~r a single query, as shown in (10). Ash';nine that Mary and Joe are brother and s:ster and both are known to Q and tL Also, Mary and...
- 4
- 331
- 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... be able to derive the discourse relations holding between adjacent text spans, and also to notice the additional semantic and pragmatic implications stemming from the usage of a particular ... words are assigned to the realm of the lexicon, whereas function words are treated as a part of grammar. For dealing with discourse markers, we do not regard this distinction as particularly...
- 5
- 528
- 0
Tài liệu Báo cáo khoa học: "TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS " docx
... recognize any given instance of the concept Canada constitutes our concept of Canada. According to a second view, Kant considers a concept as an abstract represen- tation (vorstellung) of the ... TOWARDS A THEORY OF COMPREHENSION OF DECLARATIVE CONTEXTS Fernando Gomez Department of Computer Science University of Central Florida Orlando, Florida 32816 ABSTRACT An outline of a theory ... (concepts as rules and concepts as a structural representation). We have based our analysis on Kant's distinction in order to separate clearly between the organization of the inferences and...
- 8
- 323
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–463R ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG SmaIrFnBPB163–308F GGGGGATCCGGTACAGATGTAACAAATAAAG BamHIrFnBPB163–308R CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF F GGATCAATAGCTAGAGCTAAAGATAATTCFnBPB(–142–480)F GCAGAATTCGTCGGCTTGAAATACGCTG EcoRIFnBPB(–142–480)R AATGGATCCTTACTTTAGTTTATCTTTGCCG BamHIFnBPB(388–980)F CCCAAGCTTGATGATGTCAGC Hind ... CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA SmaIrFnBPB309–480F CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT BamHIrFnBPB309–480R AATCCCGGGTTACTTTAGTTTATCTTTGCCG SmaIrFnBPB163–480NF F GAATTATCTTTAGCTCTAGCTATTGATCCrFnBPB163–480NF...
- 13
- 514
- 0
Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx
... et al. (2005). The re-search established that even a small amount of ad-ditional training data can give a substantial im-provement in question analysis in terms of bothCFG parse accuracy and ... from appropri-ate treebank material. However, treebank- andmachine learning-based grammatical resources re-flect the characteristics of the training data. Theygenerally underperform on test data ... for a given language or task.Large treebanks are available for major languages,however these are often based on a specific texttype or genre, e.g. financial newspaper text (thePenn-II Treebank...
- 8
- 405
- 0
Báo cáo khoa học: Macrocypins, a family of cysteine protease inhibitors from the basidiomycete Macrolepiota procera pot
... cysteine proteasespapain, cathepsin L and cathepsin V using benzyloxycar-bonyl (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) assubstrate, and for legumain with Z-Ala-Ala-Asn-AMC asthe substrate, while ... pooled,concentrated by ultrafiltration (Amicon UM-10; Millipore,Vienna, Austria) and dialyzed against 0.02 m Tris–HCl, pH7.5. The sample was then applied to a column of DEAE–Sephacel (Pharmacia-LKB, Uppsala, ... proteolyticmechanisms and protein–protein interactions, and asbiocidal agents against various organisms. There areseveral groups of inhibitors, mainly from animal andplant origins, that specifically...
- 12
- 368
- 0
Báo cáo khoa học: "Generating a Table-of-Contents" pptx
... Table -of- ContentsS.R.K. Branavan, Pawan Deshpande and Regina BarzilayMassachusetts Institute of Technology{branavan, pawand, regina}@csail.mit.eduAbstractThis paper presents a method for the auto-matic ... Most of these approaches are tailored to a par-1The code and feature vector data forour model and the baselines are available athttp://people.csail.mit.edu/branavan/code/toc.ticular domain, ... hierarchical discriminativeapproach for table -of- contents generation. Figure 1shows a fragment of a table -of- contents automat-ically generated by this algorithm. Our methodhas two important points...
- 8
- 353
- 0
Báo cáo khoa học: "Representing a System of Lexical Types Using Default Unification" pdf
... a single value. Moreover, default specifications can be made to act as indefeasible information, using YADU's DefFill operation (Las- carides and Copestake, 1999), that has a TDFS as ... ties about classes of items that behave similarly. This idea is employed in Pollard and Sag's (1987) sketch of an HPSG lexicon as a monotonic mul- tiple orthogonal inheritance type hierarchy. ... and Copestake, 1999), to implement a de- fault inheritance network results in a fully declar- ative specification of a lexical fragment based on Pollard and Sag's (1987), but that is both...
- 4
- 285
- 0
Tài liệu Báo cáo khoa học: "The Incremental Generation of Passive Sentences" pot
... auxil- iary is treated as an argument-attraction verb (cf. Hinrichs & Nakazawa 1991): It subcategorizes for a passive participle and attracts the arguments that the par- ticiple subcategorizes ... other approaches to the computational modelling of empirically substantiated features of human language production, such as Kempen & Hoenkamp's (1987) Incremental Procedural Grammar and ... languages such as German and Dutch, where passivization is essentially a morphological process. A different parametrical variation, such as the development of the auxiliary into a syntactic...
- 9
- 379
- 0
Tài liệu Báo cáo khoa học: "Experiments in Reusability of Grammatical Resources" pot
... Experiments in Reusability of Grammatical Resources Doug Arnold ° Toni Badia ®, Josef van Genabith% Stella Markantonatou ° Stefan Momma% Louisa Sadler °, Paul Schmidt ° °Dept of Language and Linguistics, ... automatic, semi-automatic and manual migration of implemented grammatical and lexical resources and of textbook specifications, writ- ten in various 'styles', to the ALEP formalism ... treated. The resulting translation is not as perspicuous, modular, compact and maintainable as the original HPSG specification. Migration results in a fragmen- tation and particularisation of...
- 9
- 338
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP