Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes speciﬁcally binds to the 5¢ untranslated region of the psbA mRNA potx

... +13relative to the AUG); T7 -psbA5 ¢ (5¢- GTAATACGACTCACTATAGGGTACCATGCTTTTAATAGAAG-3¢)and2054 (5¢- GATCCATGGTCATATGTTAATTTTTTTAAAG-3¢); )36 -RNA (wild-type sequence of the psbA mRNA corresponding to positions ... )36 to +13 relative to the AUG); T7–36ntA5¢ (5¢- GTAATACGACTCACTATAGGGTTTACGGAGAAATTAAAAC-3¢) and 2054; M1- RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG ... C-terminalamino acids of D1 and the 3¢ UTR of the psbA mRNA) wasampliﬁed with the oligonucleotides psbA3 /1 (5¢- CTCTAGCTCAAACAACT-3¢)andpsbA3/2 (5¢- GCCTATGGTAGCTATTA)3¢) and cloned into the pBluescriptII...

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterﬂy, Papilio xuthus docx

... RBPpuriﬁed from dark-adapted or light-adapted retinas, and analyzed byHPLC. The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinolwas then calculated based on the absorbance and the molar ... light adaptation of the eye. Light adaptation alsoinduced the decrease of all-trans isomer both in the distaland proximal portions of the retina. In contrast, the increase of 11-cis ligand was ... intrinsicligands of Papilio RBP extracted separately from the distaland proximal portions of the retina. Papilio RBP wasextracted from each portion of the dark-adapted or light-adapted retina, and puriﬁed...

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

... with a pair of primers (forward, 5¢- CACCACCACCACCAGATGGGTTACTGGAATTCCAAG-3¢; reverse, 5¢- GTGGTGTTTCATATGTATATCTCCTTCTTAAAGTTAAAC-3¢; italic type shows the His-tagadaptor sites). After conﬁrmation ... Lanes 1 and 6, A. thaliana; lanes 2 and 7, Raphanus sativus; lanes 3 and 8, Brassica rapa;lanes 4 and 9, B. rapa var. glabra; lanes 5 and 10, B. oleracea var. italica. The amount of protein applied ... showed bands in Raphanus sativus(radish, 41 kDa), Brassica rapa (turnip, 42 kDa),Brassica rapa var. glabra Regel (Chinese cabbage, A novel cation -binding myristoylated protein N. Nagasaki et al.2268...

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... For the detection of the unsplicedpgRNA and the SP1 splicing variant of HBV, primers SP1(tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) andU2 (ttccaatgaggattaaagacag) were used.Quantiﬁcation ... PRE-ISS. (A) RNase footprinting analysis of the fragments of the 5¢ endlabeled and folded PRE-ISS wild-type RNA, which was cleaved by RNase T1, RNase V1 and RNase A. The T1 seq and A seq lanes representRNase ... intensity of RNase cleavage signals, and asterisks indicate RNase V1 signals inunpaired regions. (B) Deduced secondary structure of the PRE-ISS RNA. RNase T1, RNase V1 and RNase A signals are superimposed...

Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classiﬁcation pptx

... Kyoto, Japan).RACE 5¢- RACE and 3¢-RACE were performed on the RACE-ready cDNA prepared from previously isolated total RNA with the GeneRacer Kit (Invitrogen, Carlsbad, CA, USA).For the 3¢-RACE ... huntingand defense) of the sea anemone Adamsia carciniopados(AcPLA2) [20]. Nested RT-PCR with degenerateprimers and RACE was used to clone the PLA2 from this animal. AcPLA2contains a putative ... 1D). The N-terminal amino acid analysisrevealed that the protein of  14 kDa was homologous to PLA2s (UcPLA2), whereas the protein of  20 kDaNew PLA2 from Urticina crassicornis A. Razpotnik...

Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... oligo-merization, translocates from the ER membrane to form ‘punctae’ near the plasma membrane [1,3,4] andactivates the Ca2+release-activated Ca2+(CRAC)channel through direct interaction with the ... ‘punctae’ and aggregates near the plasma membrane [1,6]. The N-terminal region of STIM1 contains a canonical EF-hand motif and a pre-dicted SAM domain. Stathopulos et al. [23,24] isolated the ... for the observedcooperativity of Ca2+ binding to EF-hand protein domains. Our laboratory has developed a graftingapproach to probe the site-speciﬁc Ca2+ -binding afﬁni-ties and metal-binding...

Báo cáo khoa học: cAMP response element-binding protein (CREB) is imported into mitochondria and promotes protein synthesis docx

... is an autoradiogram of anamount of the radioactive CREB synthesis mixture corresponding to half of the amount added to mitochondria for the import assay.No precipitable aggregate of radioactive ... synthesized in the RRLtranslation system, was added to isolated rat liver mitochondria. (A, C) Autoradiograms of SDS ⁄ PAGE slabs of the mitochondrialpellet. The RRL gel slab on the left of (A) ... Robin M, Prabu S, Raza H, Anandatheerthavarada H& Avadhani G (2003) Phosphorylation enhances mito-chondrial targeting of GSTA4-4 through increasedafﬁnity for binding to cytoplasmic Hsp70....

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magniﬁca – a step into the invertebrate world of proteases pdf

... granulifera, Cassiopeaxamachana, Condylactys gigantea, Gorgonia ventalina,Lebrunia danae, Palythoa caribaeorum, Physalia phy-salis, Plexaura homomalla, Stichodactyla helianthus andZoanthus pulchellus); ... belong-ing to the Phyla Cnidaria, Annelida, Mollusca, Echi-nodermata, Arthropoda and Chordata, amongstothers, collected on the coasts of Havana, Cuba. The study has been based on the use of N-(4-meth-oxyphenylazoformyl)-l-phenylalanine ... the kingdom Methazoa(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,Mollusca, Artropoda) were collected in the north coast of Havana and classiﬁed by Cuban specialists at the NationalInstitute...

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

... 5¢- GGAGAAAGTCCGTCTATGGTGGTGTGCAGATGACACAGTTTTGGC-3¢; site 3A1 -600: 5¢- GCCTCTGCTCTGTAAGTGCAGGACCGTAGAGGTCTATTACTTATG-3¢. mRNA analysisTotal liver RNA was extracted by a modiﬁcation of the ... time-course variation of the relative concentrations of C/EBPa mRNAandproteinwasmonitoredintheratliver.In parallel we also followed the accumulation of the CYP 3A1 mRNA, upon addition of dexamethasone(Fig. ... regulatory sites. The in vivoobservations of the induction of C/EBPa mRNA and protein preceding the accumulation of CYP 3A1 mRNA inrat liver suggest the importance of the characterizedC/EBPa promoter...

Báo cáo khoa học: Double-stranded RNA-dependent protein kinase (PKR) is downregulated by phorbol ester ppt

... Mosialos G & KoromilasAE (2001) Activation of the IkappaB alpha kinase(IKK) complex by double-stranded RNA- binding defective and catalytic inactive mutants of the inter-feron-inducible protein ... protein kinase-dependent pathway mediating stress-inducedapoptosis. Proc Natl Acad Sci USA 94, 3279–3283.13 Balachandran S, Kim CN, Yeh WC, Mak TW, BhallaK & Barber GN (1998) Activation of the dsRNA-dependent ... degradation of STAT2 andSTAT3 in neuroblastoma cells through the PKC-dependent phosphorylation and the proteasome path-way, suggesting a role of PMA in the regulation of cytokine signalling...

Xem thêm