Báo cáo khoa học: Schemes of ﬂux control in a model of Saccharomyces cerevisiae glycolysis docx

... Vmaxparameters was used as the base model for parameterscanning using routines contained in GEPASI.METHODS Model A model of branched glycolysis, as described in [7] wasobtained in SCAMPformat ... glycolytic pathway.Much effort has already been invested in mathematicalmodelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasitethat causes ... multivariate and machinelearning approaches are appropriate for such problems, andso we used the evolutionary programming algorithmsincorporated in the metabolic modelling packageGEPASI[14–16]...

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... this strainand the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosinereports on the chorismate mutase activity ... interactions [21].If a smaller set of amino acids is structurally andfunctionally viable, then complete sampling becomesfeasible for libraries in which a larger number of aminoacids are varied ... (proposed) natural domain-swapping evolution-ary process, domain unswapping relied on selection forcatalytic activity. In this case, two amino acids, Lys20 andLeu21, were duplicated and a random...

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... GCCATGCTAGCAATCATCACCGTAGCHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423MIH-LF GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR ... premoult.Materials and methodsAnimals and peptidesCarcinus maenas were collected using baited traps in theMenai Strait, UK, and maintained in a recirculatingseawater system under ambient conditions. ... GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC 100AK-SF AAACGGTCACCCTCCTTGAAK-SR ACTTCCTCGAGCTTGTCACG 1323282 J. S. Chung and S. G....

Báo cáo khoa học: Adipocyte hyperplasia and RMI1 in the treatment of obesity doc

... MINIREVIEWAdipocyte hyperplasia and RMI1 in the treatment of obesityAkira Suwa, Takeshi Kurama and Teruhiko ShimokawaDrug Discovery Research, Astellas Pharma Inc., Ibaraki, JapanIntroductionObesity ... Matsumoto, and MasanoriNaitou at Astellas Pharma Inc., and Mses ChihiroYamazaki and Rie Fujikawa at Trans Genic Inc. fortheir helpful advice and support.References1 Hausman DB, DiGirolamo ... energy, initially through an increase in adi-pocyte size. However, as adipocytes have a limitedcapacity for enlargement, long-term intake of excesscalories eventually results in an increase in adipocytenumber...

Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

... counter (LKB, Wallac, Finland). All animals weremaintained and handled according to local and nationalethical guidelines.Animal model of septic shockTwo groups, each containing 40 female NMRI mice ... IL-1b). All animals were maintained and handledaccording to local and national ethical guidelines.Statistical analysisData are represented as means ± SD. The signiﬁcance of the results was assessed ... to activatedefensive reactions such as pain (stimulating scratch-ing) and hemostasis (repairing the wound and involv-ing coagulation), as well as innate, adaptive immuneKeywords in ammatory;...

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT135mC9.R: GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC706mCARP.R: TGGCACTGATTTTGGCTCCTE2-14 ... TCACAGGACACTGAGCAATGGCTGATC1691p21.R: GTGCTTTGACACCCACGGTAUb Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG51mUbiq.P: TGTTTCGACGCGCTGGGCG96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAACardiac ankyrin ... muscleremodelling in skeletal muscle.AbbreviationsAAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,4¢,6-diamidino-2-phenylindole;...

Báo cáo khoa học: "PARSING VS. TEXT PROCESSING IN THE ANALYSIS OF DICTIONARY DEFINITIONS" pot

... is much faster. This way of looking at our results may make it appear that parsing was a waste of time and effort, of value only as a lesson in how not to go about dictionary analysis. Before ... the tagging program is the lexical analyzer, and the head finder is a syntax analyzer using a very simple finite state grammar of about ten rules. Despite its lack of linguistic sophistication, ... problem areas can be identified. One common cause of failure is the inability of the grammar to deal with all the nuances of adjective comparison: (13) accelerate 0 1 vt to bring about at an earlier...

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... problem clinically, and 40% of patients who relapse on imatinib therapy have pointmutations in the BCR–ABL kinase domain, includingthe T315I gatekeeper mutation that impairs imatinibbinding [58,59]. ... prosurvival extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2) and protein kinase B(PKB) pathways that act downstream of oncogenicprotein kinases [10,11]. It is increasingly apparent thatthese ... protein ⁄ extracellular signal-regulatedkinase kinase ⁄ mitogen-activated protein kinase inhibi-tors interact synergistically with STI571 to induceapoptosis in Bcr ⁄ Abl-expressing human leukaemia...

Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc

... Mn-SOD, catalase and glutathionereductase were from Sigma (Deisenhofen, Germany).Preparation and incubation of brain mitochondriaThis work was conducted in accordance with the regula-tions of the ... glutamate, 5 mm malate,and 200 lm ADP were added to the incubation toinduce state 3 respiration and oxygen consumptionwas analysed. The corresponding values are shown in Fig. 1. After 15 min of ... data in Fig. 5 are presented as mean values ± SEMfrom ﬁve mitochondrial preparations. Under control conditions, that is, incubation of mitochondria in Ca2+-free and air saturated medium in...

Báo cáo khoa học: Novel suppression mechanism operating in early phase of adipogenesis by positive feedback loop for enhancement of cyclooxygenase-2 expression through prostaglandin F2a receptor mediated activation of MEK⁄ ERK-CREB cascade doc

... CREB,CRE-binding protein; EIA, enzyme immunoassay; ERK, extracellular signal-regulated kinase; MEK, mitogen-activated proteinkinase ⁄ extracellular signal-regulated kinase kinase; pAb, polyclonal antibody; ... increasesthe intracellular calcium level and activates variouskinases including MEK [16,18–20]. MEK, also knownas MAPK kinase [34], is an activator of ERK, a MAPK. The MEK ⁄ ERK pathway is a ... hormone and prostaglan-din F2 alpha-stimulated mitogen-activated proteinkinase activation in cultured transgenic murine osteo-blasts. Mol Endocrinol 17, 1607–1621.39 Tokuda H, Harada A, Hirade...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ