Báo cáo Y học: Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold potx

... ribosome associated factor Y (Eur. J. Biochem. 269) 5191 Ribosome-associated factor Y adopts a fold resembling a double-stranded RNA binding domain scaffold Keqiong Ye1, Alexander Serganov1, ... genomes,and in Arabidopsis thaliana and Spinacia oleracea plantsequences. A search usingFASTA[34] andBLAST[35]revealed only a few hits with signiﬁcant identity associatedwith two strains of Salmonella ... structure of a 112-residue pY and have studied itsbackbone dynamic by NMR spectroscopy. The structurehas a babbba topology and represents a compact two-layered sandwich of two nearly parallel a helices...

Tài liệu Báo cáo khoa học: Tissue factor pathway inhibitor is highly susceptible to chymase-mediated proteolysis pptx

... tryptase. Biochemistry 40, 7342–7349.18 Nakahara Y, Miyata T, Hamuro T, Funatsu A, Miyagi M, Tsunasawa S & Kato H (1996) Aminoacid sequence and carbohydrate structure of a recom-binant ... H,Ishihara M, Yonemura H, Miyamoto S, Funatsu A, Enjyoji K, Abumiya T, Miyata T & Kato H (1994)Amino acid sequence and inhibitory activity of rhesusmonkey tissue factor pathway inhibitor ... N (1997) Chymase clea-vage of stem cell factor yields a bioactive, soluble pro-duct. Proc Natl Acad Sci USA 94, 9017–9021.48 Nakano A, Kishi F, Minami K, Wakabayashi H,Nakaya Y & Kido...

Tài liệu Báo cáo khoa học: Platelet factor 4 disrupts the intracellular signalling cascade induced by vascular endothelial growth factor by both KDR dependent and independent mechanisms ppt

... lgÆmL)1). Raf1 activity was quantiﬁed after Raf1 immunop recipitation, by means of an in vitrokinase assay. Raf1 speciﬁc activity i s expressed as relative activity (C). Values a re m eans ± SD ... CXCR3B (forward) 5¢-TGCCAGGCCTTTACACAGC-3¢; (reverse) 5¢-TCGGCGTCATTTAGCACTTG-3¢.GAPDH (forward) 5¢-CCACCCATGGCAAATTCCATGGCA-3¢; (reverse) 5¢-TCTAGACGGCAGGTCAGGTCCACC-3¢.Flow cytometryCells ... Beverly, MA, USA). Anti-PLCc1,anti-phosphotyrosine (4G10) I gs and the Raf1 immunopre-cipitation kinase cascade assay kit were obtain ed fromUpstate Biotechnology (Lake Placid, NY, USA). Anti-CD-31...

Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf

... a multigene family is regulated by transcription factor TFIIIBAkhila Parthasarthy and Karumathil P. GopinathanDepartment of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, ... derivative of tRNAGly1-1 has a single TATA ele-ment at )130 bp and is transcribed to the same levels as theparent. pmutRKX3 has the single TATATAA element ofpRKX3 mutated to GATATCA. tRNAGly1-6,7 ... overall availability of transcription factors.We made a comparative analysis of two tRNAGly1gene copies, which belonged to the highly and poorlytranscribed groups. The lower stability of...

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... 17] a s a template and the primersRRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGAAGAAAAATAATGAAC-3¢, SacI site underlined) andTorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGCTTGATGTAATC-3¢, BamHI site underlined). ... 5B, lane 10). Similarly, steady state analysis did not A BFig. 4. In vivo analysis of S ufI export in Dtig, DdnaKdnaJ and DtigDdnaKdnaJ mu tants. S teady state (A) and pulse-chase (B) analysis ... beenidentiﬁed as a second post-translational targeting/trans-location pathway t hat operates i ndependently of the Secpathway (reviewed in [11]). In contrast to the Sec pathway,the Tat pathway has the...

Báo cáo khoa học: Nuclear factor TDP-43 can affect selected microRNA levels pptx

... possibility thatwarrants experimental testing in the future.let-7b RNA Pol IImiR-663 RNA Pol IImiR-574-5p RNA Pol IImiR-558 RNA Pol IIm7GAAAAAm7GAAAAAm7GAAAAAm7GAAAAApri-let-7bpri-miR-663pri-miR-574-5ppri-miR-558pre-miRNAmiRNATDP-43Gene(s) ... antibody (Abcam, Cambridge, MA, USA).Microarray and direct miRNA analysisTotal RNA from TDP-43 siRNA, control siRNA-treated(siCONTROL nontargeting siRNA #2) and untreatedHep-3B cells were obtained ... glyceraldehyde-3-phosphatedehydrogenase; GST, glutathione S-transferase; LAMC1, laminin, gamma 1 (formerly LAMB2); miRNA, microRNA; siRNA, short inhibitory RNA; STX3, syntaxin 3; VAMP3, vesicle-associated membrane...

Báo cáo khoa học: Complement factor 5a receptor chimeras reveal the importance of lipid-facing residues in transport competence doc

... USA2 Laboratory for Molecular Cardiology, Danish National Research Foundation Centre for Cardiac Arrhythmia, The Heart Centre, CopenhagenUniversity Hospital, Denmark3 Laboratory for Molecular ... display a lower binding afﬁnity similar tothe BFA-treated wild-type receptor and, based on ourlocalization data, fail to reach the plasma membrane.This internal receptor population is properly ... Molecular Cardiology, Danish National Research Foundation Centre for Cardiac Arrhythmia, Department of Neuroscienceand Pharmacology, University of Copenhagen, Denmark4 Department of Biochemistry and...

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-speciﬁc Rnf33⁄Trim60 gene pot

... this work and were maintained at the Laboratory Ani-mal Centre of the National Yang Ming University, Taipei.This study was approved by the Institutional Animal Careand Use Committee (IACUC) of ... statistical analysis of the luciferase assay data; values ofP < 0.05 were considered signiﬁcant.Preparation of nuclear extracts and total proteinlysatesNuclear extracts and protein lysates ... (5¢-GCCTCCTGCACCACCAACTG-3¢) andGAPDH-R (5¢-CCAGTAGAGGCAGGGATGATGT-3¢).The real-time PCR program was: pre-incubation at 50 °C for2 min; initial denaturation at 95 °C for 7 min; and 45 cyclesat 95...

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... triplicate.GALNS enzyme activityGALNS activity was assayed with 4-methylumbeliferyl-b-d-galactopyranoside-6-sulfate (Toronto Chemicals Research,North York, Canada) as a substrate. The enzyme assaywas ... [2].Keywordsadeno-associated virus-derived vector;cytomegalovirus immediate earlyenhancer ⁄ promoter; mucopolysaccharidosisIVA; N-acetylgalatosamine-6-sulfatesulfatase; sulfatase-modifying factor ... Surolia I, Chouthai N,Zhao W, Maina N, Srivastava A & Stacpoole P (2008) A combined therapeutic approach for pyruvate dehy-drogenase deﬁciency using self-complementary adeno-associated...

Báo cáo khoa học: Transcription factor speciﬁcity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TGTGGCTCTGTGGAACATTTSp1FP GGACTACCTGGAGTGATGCCTAASp1RP CCCATCAACGGTCTGGAACTAP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCRAP- 2a RP CAGGTCGGTGAACTCTTTGCAb-actinFP GCGCGGCTACAGCTTCAb-actinRP CTTAATGTCACGCACGATTTCCFig. ... ChIPSp1 ⁄ chipF GGACTACCTGGAGTGATGCCTAA ChIPSp1 ⁄ chipR CCCATCAACGGTCTGGAACT ChIPAP- 2a ⁄ si GCUCCACCUCGAAGUACAATT RNAiSp1 ⁄ si NNAGCGCUUCAUGAGGAGUGA RNAiKCTD10FP TTGCGGTTTAGGTACATCCAKCTD10RP TGTGGCTCTGTGGAACATTTSp1FP ... +30)-F5 GGGGTACCAACGGACGGCTTAAGACGTTP()13 ⁄ +30)-F6 GGGGTACCCCGGCTGGCGTGAGCTGGGTP()609 ⁄ )241)-R CCAAGCTTTTCCTTCCCGGGCGAAGAAGAP- 2a ⁄ chipF GGGGCGGAAGTGGGGTG ChIPAP- 2a ⁄ chipR GAAAAGTCGGAGGACG ChIPSp1...

Xem thêm

Từ khóa: báo cáo khoa học y học báo cáo y học báo cáo y học cổ truyền báo cáo y tế học đường mẫu báo cáo y tế học đường báo cáo y tế học đường cuối năm Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ