Báo cáo khoa học: Puriﬁcation, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris Masahiro Sugimura1, Hirofumi Watanabe1, Nathan ... endo-b-1,4-glucanase and b-glucosidase, have been detected in the gut of P. hilaris larvae and adults [8].To clarify further the cellulase activity in P. hilaris, wepurified, characterized and obtained the ... Japan A cellulase (endo-b-1,4-glucanase, EC 3.2.1.4) was purified from the gut of larvae of the yellow-spotted longicorn beetle Psacothea hilaris by acetone precipitation and elution from gels after...

Báo cáo Y học: Puriﬁcation, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx

... 2400 VÆh)1at a constant power of 18 W, at10 °C and continuous buffer circulation in a DESAGAVA-200 apparatus (DESAGA, Germany). After separ-ation, the protein bands were cut out and the gel ... spectra after alternative irradiation with the two light qualities.Mass spectrometry and N-terminal amino acid sequencing Mass spectrometry of the a- PEC peptides originating from the preparation of ... inﬂuence of lighton the crystal packing of a- PEC during the measurementsremains uncertain.Puriﬁcation and analyses of a- PEC peptides The storage time of a- PEC in 0.3% (v/v) formic acid at 4 °Cwas...

Báo cáo khoa học: Puriﬁcation, characterization and molecular cloning of tyrosinase from the cephalopod mollusk, Illex argentinus docx

... bp of the 5¢untranslated regions and the 3¢ untranslated regionscontaining polyadenylation signals (AATAAA) at threepositions and the poly (A) -tails. The criteria for a consensustranslation ... lLofwater.First strand cDNAs for 5¢ -and3 ¢-RACE were prepared from the ink sac poly (A) +RNA using a SMART RACE cDNA Ampliﬁcation kit (Clontech, Palo Alto, CA, USA)according to the manufacturer’s instructions. ... Biosystems). The nucleotide sequence data areavailable in the DDBJ/EMBL/GenBank databases under the accession numbers AB107880 and AB107881 for the squid tyrosinase ST94 cDNA- 1 and cDNA- 2, respectively.Sequence...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... China Sea. Sephadex G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and triﬂuoroacetic ... precursorsequence of conomarphin. The signal pep-tide is shadowed and the mature peptide isunderlined. The polyA signal AATAAA in the 3¢-UTR is also underlined. The cDNA of con-omarphin has been deposited...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... number AI563351) was used to design fourGAT-speciﬁc primers; CLGAT 5a (5¢-GGCATCAACAT-CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT-CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT 3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) ... FEBSPuriﬁcation and characterization of glutamateN-acetyltransferase involved in citrulline accumulationin wild watermelonKentaro Takahara, Kinya Akashi and Akiho YokotaGraduate School of Biological ... NotI-d(T)18bifunctional primer (5¢-TAA-CTGGAAGAATTCGCGGCCGCAGGAAT(18)-3¢). The single-stranded cDNA was used for PCR w ith the primers Not1(5¢-AACTGGAAGAATTCGCGGCCGC-3¢) and CLGAT 3a. An aliquot from t...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from 1 g of abalone hepatopancreas by the ganidiniumthiocyanate-phenol method [30] and mRNA ... Tokyo, Japan) and used as an abalone cDNA library. cDNAs encoding abalone cellulase were amplifiedby PCR from the cDNA library with degenerated primerssynthesized on the basis of partial amino-acid...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crabParatelphusa jacquemontiiMaghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya SuriyaDepartment ... SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressedO-acetyl sialic acid ... sialidasetypeX,proteaseenzymes and molecular mass standards were purchased from Sigma.Preparation of crab seraFreshwater field crabs, Paratelphusa jacquemontii werecollected from the local...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... with anapparent molecular mass of 53 kDa appears as a double band inunboiled samples (lanes A1 and B1).Table 1. N-Terminal sequences of the polypeptides of the puriﬁed enzyme. N-Terminal sequen ... with g values at 2.031,1.994, and 1.951. The resonance started to develop atpotentials ‡ 0 mV and was stable at potentials up to+350 mV. The loss and formation of the resonance wasassociated ... related to the catalyticsubunit of Hdr from methanogenic archaea have beendeposited in the databases. None of these putative pro teinshas b een c haracterized and no f unction has been assigned...

Báo cáo khoa học: Puriﬁcation and characterization of zebraﬁsh hatching enzyme – an evolutionary aspect of the mechanism of egg envelope digestion pot

... forward: 5¢-CTGAACTTCTCTACACACTGAGG-3¢, reverse: 5¢-CCTTATCACCATCACCTCACTTC-3¢; ZHE2 forward: 5¢-CTCCACACACTGAGACTAAATGG-3¢, reverse: 5¢-GGAAATAAGAGCACGTACTGTGG-3¢. The cycle number of PCR was ... Most of the activitywas retained in the column and eluted at the concen-tration of approximately 0.35 m NaCl as a sharp singlepeak. SDS ⁄ PAGE of the active fraction gave a singleband, with an ... using a sense primer, 5¢-CATATGAATGCTCTCATCTG CGAGGACA-3¢, containing a 5¢ NdeI site and start methionine resi-due, and an antisense primer, 5¢-GGATCCTAGTGATGGTGATGGTGGCATCCATACAGCTTATTGATCC-3¢,which...

Báo cáo khoa học: Puriﬁcation and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

... translation showed that they hold the characteristic features of all known papain-class cysteine proteinases, and a phylogenetic analysis revealed the existence of several papain and chymopapain ... completecDNAs from papain, glycyl endopeptidase, two iso-forms of caricain and ﬁve isoforms of chymopapain from C. papaya. From the genus Vasconcellea, only the latex of V. cundinamarcensis has previously ... commonancestor of the genera Carica and Vasconcelleaalready contained at least two different cysteine pro-teinases in its latex (papain and chymopapain). After the divergence of these genera, their...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP