Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

... JaBot: a multilingual Java-based intelligent agent for Web sites Tim READ & Elena BARCENA Departamento de Filologias Extranjeras y sus Lingi isticas, UNED Senda del Rey s/n, Madrid ... of usage, and distributed operation across the Web (Read et al., 1997). These benefits make Java an ideal programming language for constructing Web- based computational linguistic applications ... relevant for their careers. As can be seen in the diagram below, JaBot has three modules: a natural language interface, a search engine and an interactive list of references to the Web pages...

Báo cáo khoa học: "Investigating a Generic Paraphrase-based Approach for Relation Extraction" pdf

... relative to a standardapplication dataset. It is also the first evaluation of a generic paraphrase-based approach for the stan-dard RE setting. Our findings are encouraging for both goals, particularly ... workson paraphrasing (http://nlp.nagaokaut.ac.jp/IWP2005/).410lation. Ravichandran and Hovy (2002) evaluatedthe performance of a QA system that is basedsolely on paraphrases, an approach resemblingours. ... at a dual goal: obtaining an applicativeevaluation scheme for paraphrase acquisi-tion and obtaining a generic and largelyunsupervised configuration for RE. We an-alyze the potential of our approach...

Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

... length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... two kinds of tests on the paragraphsin this span: a test of paragraph content, and a testof paragraphs relative size matching. The first testcompares the paragraphs' numbering (if present).The...

Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme ... similar to what many people have proposed for evaluation (Davidov et al. 2010; Sun et al. 2010; Bifet and Frank 2010; Go et al. 2009; Pak and Paroubek 2010; Chen et al. 2010). We use data from...

Tài liệu Báo cáo khoa học: "Translating a Unification Grammar with Disjunctions into Logical Constraints" pdf

... Translating a Unification Grammar with Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... E-mail: nakano@atom.brl.ntt.co.jp, shimazu@jaist.ac.jp Abstract This paper proposes a method for generating a logical- constraint-based internal representation from a unification grammar formalism ... unification-based approach is that it enables us to describe grammar declaratively, making the development and amendment of grammar easy. Analysis systems that are based on unification gram- mars can...

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for example, because, since, and for this reason are different markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they signal a concessive relationship ... that a dedicated discourse marker lexicon holding this kind of information can serve as a valuable resource for natural language pro- cessing. Our efforts in constructing that lexicon are...

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach to annotate a ... from a semantic representation. In general, a particular interpretation of a sentence can be represented by an annotated syntax tree (AST), which is a syntax tree annotated with fea- ture...

Xem thêm