Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

... future research tracks to improve para-phrase generation tools.2 Statistical paraphrase generation usingtransformation rulesThe paraphrase generation problem can be seen asan exploration problem. ... In particular,it does not put constraint on the scoring function.We propose a variation of the UCT algorithm for paraphrase generation named MCPG for Monte-Carlo based Paraphrase Generation. The ... that is based on transformation rule applicationin section 2. In section 3 we propose a paraphrase generation method for this paradigm based on analgorithm used in two-player games. Section...

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-speciﬁc blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vesselendothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde;...

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... for-ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAATCATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-TATACTATCCTCGAGCCACTGCATATCACGGATACGACGC-3¢. The forward primer incorporated an NdeI siteand the ... ethyleneglycol.Gel filtration chromatographyGel filtration chromatography was performed on a SMART chromatographic workstation (Pharmacia, GEHealthcare Biosciences AB, Uppsala, Sweden), using ananalytical Superdex-200 ... XhoI restriction site.Likewise, we also amplified the cDNA for bB2 using for-ward primer 5¢-ACTTATACTACTCATATGCTCAACCCCAAGATCATC-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATGTCCCGG-3¢,...

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

... Merck KGaA (Darmstadt,Germany) and J T Baker Italia (Milan, Italy).Enzyme assays and identification of reactionproductsEnzyme assaysThe AMP–AMP phosphotransferase assay mixture con-tained 4.0 ... protein preparations. ADA was also isolated.When ADA was added to the assay mixture, AMP–AMP phosphotransferase activity was greatlyenhanced.The purifications were performed as reported inTable ... to ADP.Enzyme purification and identification by massspectrometryProtein purification demonstrated that ADP forma-tion occurred via the activities of MK and AdK, withthe cooperation of ADA....

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... 182–191.26 Altschul SF, Madden TL, Schaffer AA, Zhang J,Zhang Z, Miller W & Lipman DJ (1997) GappedBLAST and PSI-BLAST: a new generation of proteindatabase search programs. Nucleic Acids Res ... orders of magnitude. When viewed as a whole, it is apparentthat these mutations have had the most beneﬁcialeffect on the decarboxylation of 2-ketopentanoic acid.Each variant has a Kmvalue ... transcription of Aro80target genes [14]. Therefore, potentially, ARO10 andits associated genes may be responsible for the catabo-lism of aromatic and branched-chain amino acids, aswell as...

Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

... 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgctagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atggaacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaacaggccttgtgtcctgtgagacg catctgtacgtctctagcatacagccttcagcaagcctccagagctctagaag-3¢, ... 5¢-tcgagaaggtatattgctgttgacagtgagcgagag acggaagccacagacgtctcatg cctactgcctcgg-3¢ and 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgtctctcgctcactgtcaacagcaatataccttc-3¢ into the XhoI and EcoRIsites of the resulting plasmid. ... thenligated to a pair of oligos containing several restrictionsites, 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacctattggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtaccgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctatctggtccacgcgtatgcgatatcagcagctagcgccg-3¢,...

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... lab worksimage acquisition and analysis software was used to quan-tify band intensities. Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are ... complementarity, and are rarely fully comple-mentary; therefore, they function through translationalrepression rather than cleavage [5]. On the basis of this, miRNAs could control as many as 30% of allprotein-coding ... 2011)doi:10.1111/j.1742-4658.2011.08120.xMicroRNAs are a class of small noncoding RNAs that function as key reg-ulators of gene expression at the post-transcriptional level. Recently, micr-oRNA-373 (miR-373) has been found to function as an...

Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

... 5¢-ATGGTAGGTCTCAAATGATAGGAAATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev,5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCATTTTTTGC-3¢.The gene mm0632 was cloned via BsaI restriction sites inplasmid pASK-IBA3 ... [Fe(N-His)4(SCys)] mononuclear iron center. Treponema palli-dum contains a variant of desulfoferrodoxin (class IIISOR), composed of the C-terminal domain and a N-terminal domain that does not contain an[Fe(SCys)4] ... structure of a monofunctional catalase fromMethanosarcina barkeri. Arch Microbiol 171, 317–323.39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK &Shima S (2000) Protection of Methanosarcina barkeriagainst...

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... data that could allow for a struc-tured evaluation of the organizational changes. It is evi-dent that a well-planned evaluation of changes in theorganizations, before they are actually made, ... emergencymedical call centre organization reform in Finland.Material and methods A retrospective observational study was conducted inthe EMCC in East and Central Uusimaa, an area of southern Finland ... review board.Data in this studyThe selected old municipality -based centers had compu-ter -based statistical data on EMD assignments and ambu-lance feedback, which made a comparison on a grouplevel...

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... metabolitePrashant N. Jethva, Jay R. Kardani and Ipsita RoyDepartment of Biotechnology, National Institute of Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, IndiaIntroductionThe inability of ... effect of 50 lm dopamine on the aggregation process. Dopamine delayed the lagphase of aggregation marginally to 95.5 h from 86.8 hin the presence of MPTP alone. The apparent rateconstant of aggregation ... of Parkinson’s disease [35]. It has recently been shownthat the protective action of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical...

Xem thêm