Báo cáo khoa học: "Adapting a WSJ-Trained Parser to Grammatically Noisy Text" pot
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... provide an apt summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furthermore ... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker meaning- driven, as ... discourse relations holding between adjacent text spans, and also to notice the additional semantic and pragmatic implications stemming from the usage of a particular discourse marker. We will...
- 5
- 528
- 0
Tài liệu Báo cáo khoa học: "ASSIGNING A SEMANTIC SCOPE TO OPERATORS" ppt
... hotondo-no gakusei-ga hanasu every language-ace most-gen student-nora speak d. Subete-no gengo-wa hotondo-no gakusei-ga hanasu every language-TOP most-gen student-nora speak Several proposals ... Parameters are used in SEL to trans- late anaphoric expressions of English. A parameter behaves semantically as an open variable, a value for which has to be provided by context. 7 I have assumed ... assigned to the variable x is a meeting in the situation s 1. A situation is a set of objects and facts about these objects [8, 18]. I assume a language which allows us to make state- ments about...
- 9
- 347
- 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... V-Prep-N.Another argument in favour of a full syntacticalanalysis is that it solves the problem of all cases ofextraposed elements, such as passives, topicalisa-tion, and dislocation. To illustrate...
- 4
- 479
- 0
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
... (Srini-vasamurthy & Narayanan 2003), as well as use of a small existing Farsi speech corpus (FARSDAT),and our own team-internally generated acousticdata. Language modeling data was also obtainedfrom ... both a Classifier and a stochastic translation engine, both 1 Standardized Patients are typically actors who have beentrained by doctors or nurses to portray symptoms of particularillnesses ... frequent ungrammatical orawkward translations (i.e. despite what we mightcall non-catastrophic errors).4 Testing and EvaluationIn addition to our own laboratory tests, the sys-tem was evaluated...
- 4
- 327
- 0
Báo cáo khoa học: "Automatic Compensation for Parser Figure-of-Merit Flaws*" pot
... ing at a tag stream, ignoring lexical infor- mation.) Given a few basic independence as- sumptions (Caraballo and Charniak, 1998), this value can be calculated as i i fl( N ,k) P(NJ'k]t°'~) ... possibility is that the statistical method runs into too many sparse data problems around the fringe of the data set were we able to use a larger data set, we might see the statis- tics approach the ... figure is flawed, causing a single, vital edge to remain on the agenda while the parser 'thrashes' around in other parts of the sentence with higher IM values. We could characterise...
- 6
- 380
- 0
Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" ppt
... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... V-Prep-N.Another argument in favour of a full syntacticalanalysis is that it solves the problem of all cases ofextraposed elements, such as passives, topicalisa-tion, and dislocation. To illustrate...
- 4
- 353
- 0
Báo cáo khoa học: "FOR A N EFFICIENT CONTEXT-FREE PARSER AUGMENTED PHRASE-STRUCTURE GRAMMARS" potx
... grammars, the augmented phrase-structure grammars (APSGs), and the semantic grammars. All of them have different characteristics and different advantages. In particular APSGs offer a natural ... recently, also on a SUN workstation, as the main component of a transportable Natural Language Interface (SAIL = Sistema per I'Analisi e I'lnterpretazione del Linguaggio). Subsets ... natural tool for the treatment of certain natural language phenomena, such as subject- verb agreement. Semantic grammars are prone to a compositional algorithm for semantic interpretation....
- 7
- 303
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... factor activatorinhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factoractivator; HPAI, highly pathogenic avian ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... nonribosomal peptide synthetases: theemerging view from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) ... C-terminal adenylation domain A 4again is predicted to activate l-arginine, displaying60% identity to the characterized A- domain of MycC.Interestingly, A 1and A 4inherit a highly identical(90%)...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... a heat block,and allowed to anneal until the block temperature haddecreased to room temperature.Assay procedureThe assay was run as a three-step assay: initial incubation ofthe sample and...
- 9
- 457
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ