Báo cáo khoa học: "Structural Semantic Relatedness: A Knowledge-Based Method to Named Entity Disambiguation" potx
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram ... Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutagenesis.Desired mutation Template gene Constructed mutant Primer sequence (5¢ -to3 ¢) Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA...
- 15
- 635
- 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot
... Jun-Ho Chae2,Naoshi Dohmae1, Bok Luel Lee2and Hiroshi Nakayama11 Biomolecular Characterization Team, RIKEN Advanced Science Institute, Saitama, Japan2 National Research Laboratory of ... acyl–enzymeintermediate. Biochemistry 49, 341–346.3 Fukuda A, Matsuyama S, Hara T, Nakayama J,Nagasawa H & Tokuda H (2002) Aminoacylation ofthe N-terminal cysteine is essential for Lol-dependentrelease ... inEscherichia coli. J Biol Chem 280, 974–983.32 Kodama K, Fukuzawa S, Nakayama H, Kigawa T,Sakamoto K, Yabuki T, Matsuda N, Shirouzu M,Takio K, Tachibana K et al. (2006) Regioselectivecarbon–carbon...
- 13
- 407
- 0
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... theNa+-translocating F-ATP synthase from I. tartaricusseems to be particularly suitable for structural investi-gations. For a more detailed characterization of thissystem, and to increase experimental ... primers:Structural evidence for a constant c11ring stoichiometry T. Meier et al.5480 FEBS Journal 272 (2005) 5474–5483 ª 2005 FEBS5¢-GGAGGAAATAAGCATATGGATATG-3¢ (forward),containing an NdeI site, and ... Ilyobacter tartaricus (lane 1) was applied onto a prepara-tive SDS gel. After the run, the c11band was cut out with a scalpeland the protein was electroeluted from the gel pieces to obtainpure...
- 10
- 477
- 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... to encode a sialyltransferase that adds Neu5Ac in an a- 2,3-linkage to lactose in other H. influenzae strains, is presentin strain 981 (data not shown). Sialyllactose is known to contribute to the ... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relativeabundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... proportions of thevarious alditol acetates and partially methylated alditolacetates obtained in sugar- and methylation analysescorrespond to the detector response of the GLC-MS.Permethylation of dephosphorylated...
- 13
- 433
- 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... the top-downapproach deserve consideration for important pro-teomics research.AcknowledgementsWe thank Barbara Baird, Ian Jardine, Neil Kelleher,Harold Scheraga and Klaas van Wyck for valuablediscussions, ... these fragment mass values originatefrom the same molecular ions, so they must all becharacteristic of that protein’s sequence and molecularmass value. Thus, top-down data can give an accuracyF. ... electrosprayionization. Proc Natl Acad Sci USA 86, 9075–9078.4 Tanaka K, Waki H, Ido Y, Akita S, Yoshida Y &Yoshida T (1988) Protein and polymer analyses up to m ⁄ z 100,000 by laser ionization time-of-flight...
- 13
- 572
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI siteand an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... maximal activitytowards pNPP at an acidic pH, around 5.5, and Tt SurEwas maximally active at pH 8.2. St SurE shows almostno activity in the absence of divalent metal ions. Activa-tion by various...
- 10
- 553
- 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... FEBSStructural and functional investigations of Ureaplasmaparvum UMP kinase – a potential antibacterial drug targetLouise Egeblad-Welin1, Martin Welin2,*, Liya Wang1and Staffan Eriksson11 Department ... UMPkinases from gram-negative and gram-positive bacteria.J Biol Chem 282, 7242–7253.18 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin A& amp;Baˆ rzu O (1998) Mutational analysis of UMPkinase ... Sismeiro O, Danchin A, Sakamato H, Gilles A- M & Baˆ rzu O (1995) Escherichiacoli UMP-kinase, a member of the aspartokinase family,is a hexamer regulated by guanine nucleotides andUTP. Biochemistry...
- 12
- 656
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronariaRaka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta andSampa BiswasCrystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallizationand preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55, ... TGTTGATTGGAGAGCGA AAG-3 ¢ (forward) and 5¢-GGGATAATAAGGTAATCTAGTGATTCCAC-3¢ (reverse). PCR-amplified products were purified from 1% agarose gel andligated to the pTZ57R ⁄ T vector with the T ⁄ A...
- 14
- 634
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... Kpn1 and Nco1 sites using a forwardoligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization ... oligomers5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAACCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAATTATCGCCCCTCCCGCC-3¢ (reverse).Virus amplification was performed in monolayer SF21cells, and protein expression was ... with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus using oligomers5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3¢ (reverse)....
- 10
- 647
- 0
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt
... that all PAS-annotated A. thaliana proteins alsocontain a PAC motif, and conversely that all PAC-annotated A. thaliana proteins contain a PAS domain.Therefore, in the case of A. thaliana,thePASandPACmotifs ... R674–R677.4.Kasahara,M.,Swartz,T.E.,Olney,M .A. ,Onodera ,A. ,Mochizuki,N.,Fukuzawa,H.,Asamizu,E.,Tabata,S.,Kanegae,H., Takano, M., Christie, J.M., Nagatani, A. & Briggs, W.R.(2002) Photochemical properties ... of all A. thaliana sequences that are either annotated as a PFAM PAS domain or as a PFAM PAC motif. Regions of sequences thathave an amino acid sequence similarity >35%, are depicted in black...
- 11
- 592
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ