Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ Takayasu Kawasaki1, Mudeppa D. Gouda1, Tatsuya Sawasaki1,2, Kazuyuki Takai1,2and ... 5¢-CAAAAAATTGAATGGCATGAACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAAAAATATCATTTAAACCCGACGGGCTGCTTTT-3¢(the sequences for the biotin tag are underlined) followed bycircularization with DNA ligase.Preparation of mRNAsThe pEU plasmids ... the wheat- germ system might have a practical advantage over thebacterial cell-free system. The scFv against SalmonellaO-antigen was for the first time prepared successfully through an E. coli...
- 7
- 330
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... participates ingrowth regulation of human breast carcinoma cells.Oncogene 20, 2499–2513.9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M,Nakajima T, Kawashima T, Nanakin A, Sawabu T,Uenoyama Y ... (2006)Stattic: a small-molecule inhibitor of STAT3 activationand dimerization. Chem Biol 13, 1235–1242.30 Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V,Cao A, Cymbalista F, Bogdanov A Jr & Fagard ... they are treated withIFN-c, we can tentatively conclude that it interactswith the activated forms of STAT3 and STAT1. Theactions of STAT3 and STAT1 are highly entangled,they also have antagonistic...
- 11
- 558
- 0
Báo cáo khoa học: Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc
... toward cleavage of the GUC665containingsequence) is 5¢-CGGTTCGAAACCGGGCACTACAAAAACCAACTTTGCCCTGCCCCCTGATGAGGCCGAAAGGCCGAAACTTGCCCCTGGTACCCCGGATATCTTTTTTTCTATCGCGTCGACCT-3¢ and the templateencoding ... (targeted toward CUC825containingsequence) is 5¢-CGGTTCGAAACCGGGCACTACAAAAACCAACTTTCACCCTTCCGCTGATGAGGCCGAAAGGCCGAAAGGTCCCGGTGGTACCCCGGATATCTTTTTTTCTATCGCGTCGACCT-3¢. The ribozymetemplates ... Maszewska1, Tomoko Kuwabara2, Masaki Warashina2,Kazunari Taira2and Wojciech J. Stec11Centre of Molecular and Macromolecular Studies, Polish Academy of Sciences, Department of Bioorganic...
- 9
- 434
- 0
Báo cáo khoa học: "Efficient Inference of CRFs for Large-Scale Natural Language Data" docx
... feature templates. A template of part -of- speech tag features was added forCoNLL00, CoNLL03, and Encyclopedia. In particu-lar, all tasks except PTB and NetTalk require assigning a label to a ... whichCRFs efficiently learn and predict large-scale naturallanguage data.2 Linear-chain CRFsMany versions of CRFs have been developed for usein natural language processing, computer vision, andmachine ... of the unnormalized scores for all partial paths thatstart at t = 0 and converge at yt= i at time t. Thebackward value βt(i) similarly defines the sum of un-normalized scores for all partial...
- 4
- 400
- 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt
... clipping of a fragment of desired length and sequence from a nat-ural RNA may be a useful application. For example,RNA fragments that involve modified nucleobases areeasily obtainable from naturally ... Chemical synthesis of an artificially branchedhairpin ribozyme variant with RNA cleavage activity.Tetrahedron 60, 9273–9281.29 Komatsu Y, Kanzaki I, Koizumi M & Ohtsuka E(1995) Modification of ... reverse-joined hairpin ribozymesthat are structurally optimized and which, in addition to cleavage, catalyse efficient RNA ligation. The most efficient variant ligated its appropriateRNA substrate with a single...
- 11
- 481
- 0
Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf
... J Natl Cancer Inst 100, 109–120.77 Minakuchi Y, Takeshita F, Kosaka N, Sasaki H,Yamamoto Y, Kouno M, Honma K, Nagahara S,Hanai K, Sano A et al. (2004) Atelocollagen-mediatedsynthetic small ... prostate-specific membrane anti-gen [56]. A key advantage of aptamer-mediatedtargeted delivery systems is that RNA aptamers can befacilely obtained by in vitro transcription reaction and,therefore, ... exploredas safe and effective alternatives that are easy to beprepared and can deliver large payloads of siRNA.Nonviral carriers: Trojan horses for efficient, biocompatible and versatilesiRNA delivery...
- 14
- 599
- 0
Báo cáo khoa học: "Efficient Inference Through Cascades of Weighted Tree Transducers" ppt
... of inecomposition strategies to application of cascades of tree transducers. Tables 2a and 2b summa-rize the available methods of forward and back-ward application of cascades for recognizability-preserving ... on real data. We thus demonstratebucket-brigade and on-the-fly backward applica-tion on a typical NLP task cast as a cascade of wLNT. We adapt the Japanese-to-English transla-13Note that G2is ... √otf√ √ √ √ √(b) Backward applicationTable 2: Transducer types and available methods of forward and backward application of a cascade.oc = of ine composition, bb = bucket brigade, otf = on the...
- 9
- 335
- 0
Báo cáo khoa học: Efficient ATP synthesis by thermophilic Bacillus FoF1-ATP synthase ppt
... Kinosita and Yoshida Laboratories for help andadvice, and S. Takahashi and K. Sakamaki for encour-agement and laboratory management. This work wassupported in part by a Grants-in-Aid for SpeciallyPromoted ... examined how substrate concentrationsaffect the rate of ATP synthesis. The ADP concentra-tion was changed from 1 lm to 1 mm at a saturatingconcentration (10 mm)ofPi(Fig. 4). The data are ... dynamic light scattering (HB-550; Horiba,Kyoto, Japan) to be 170 nm (Fig. 2).ATP synthesis assay and data analysisATP synthesis by TFoF1was monitored with a lucifer-ase assay, as previously...
- 8
- 280
- 0
Báo cáo khoa học: "Efficient Path Counting Transducers for Minimum Bayes-Risk Decoding of Statistical Machine Translation Lattices" pptx
... contrast, what is neededby the approximation in Equation (1) is to iden-tify all paths containing an n-gram and accumulatetheir probabilities. The accumulation of probabil-ities at the path ... (3)The approximation replaces the sum over all pathsin the lattice by a sum over lattice n-grams. Eventhough a lattice may have many n-grams, it ispossible to extract and enumerate them exactlywhereas ... p(u|E) is calculatedseparately for each u in sequence.Allauzen et al. (2010) introduce a transducerfor simultaneous calculation of p(u|E) for all un-igrams u ∈ N1in a lattice. This transducer...
- 6
- 281
- 0
Báo cáo khoa học: "Efficient Unsupervised Discovery of Word Categories Using Symmetric Patterns and High Frequency Words" ppt
... which may bean advantage in some applications.The Russian evaluation posed a bit of a prob-lem because the Russian WordNet is not readilyavailable and its coverage is rather small. Fortu-nately, ... lexical category acquisition. We use twomain stages: discovery of pattern candidates, andidentification of the symmetric patterns among thecandidates.3.1 Pattern CandidatesAn examination of ... notoriouslyhard to evaluate. We have attempted to be asthorough as possible, using several languages andboth automatic and human evaluation. In the auto-matic part, we followed as closely as possible...
- 8
- 478
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ