Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... with a
calculated average molecular mass of 57 752 Da and the
a- subunit contains 808 amino acids with a calculated average
molecular mass of 87 392 Da. The total calculated average
molecular mass ... a functional Mo catalytic
center. The functionality is estimated as a ratio of change in
the absorbance at 450 nm after anaerobic reduction of the
enzyme with 1 m...
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... of
immunoreactivity in the latter strain was due to the inability
of the truncated protein to insert into and be stable in the
inner mitochondrial membrane or lack of detection of the
truncated protein ... c
1
and a disappearance of the intermediate form
of the Rieske protein. At the same time, the levels of
subunits 7, 8 and 9 significantly decreased in...
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... time-dependent increase of the mRNA abun-
dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and
P4ha2, starting around 4 h of hypoxia, the induction of
P4ha2 mRNA being stronger than that of P4ha1 (Fig. ... as the relative mRNA/b-actin mRNA ratio. The
mRNA/b-actin mRNA ratio of the time standards (pools)
cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data
are ther...
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... execute commands.
The main functions of ATLAS are the following :
- Editing and updating of indexing charts : compi-
lation of an external form of the chart, and
modification of the internal form ... may be represented by associating
questions to each node and the possible answers to
the arcs coming from a node ; the leaves of the tree
bear the name of...
Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx
... were
used as primary antisera (Table 3). Secondary antibodies
(anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; all
raised in goat and conjugated to alkaline-phosphatase;
Sigma, Saint Louis, ... France
Introduction
Modification of the chirality of a single aminoacyl resi-
due within a peptide chain is a subtle and intriguing
mechanism that remains poorly known to date, and...
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... The role of the ESSS protein in the assembly of a functional and stable
mammalian mitochondrial complex I (NADH-ubiquinone
oxidoreductase)
Prasanth Potluri, Nagendra Yadava and Immo ... subunits of the integral membrane-
subcomplex also assemble via the formation of distinct
and i dentifiable assembly intermediates.
The mutants promise to be valuable tools in t...
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf
... adaptations in the eye in the human lineage.
In addition to the evolution of cN and cS crystal-
lins, even more specialization in the c-crystallins has
occurred with the loss of the N-terminal ... use of animals complied with the ARVO Statement
for the Use of Animals in Ophthalmic and Vision Research
and the Intramural Animal Care and Use program of the...
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... GateCPUfor
(ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca
gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate-
HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat
gatgatgatgatgatgatg).
The ... forward: CPU-for1 (tgctctagagcg
gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-
rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat
gccaagc) and C-HIS2rev (cgggg...
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot
... and arabinogalactan [6,7]. ABNs attack the
glycosidic bonds of the a- 1,5-l-arabinan backbone,
releasing a mixture of arabinooligosaccharides and l-
arabinose [4]. These types of enzyme have attracted
much ... and
de-branched arabinans, and heteropolysaccharides
such as arabinoxylans and arabinogalactans. Arabinan
is composed of a- 1,5-linked l-arabinofuranosyl units,
some of...
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/
TRAF1, respectively. Primers for amplifying the 4-1BB and
TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA
AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG
CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1
cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG
AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG
GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In
order to overexpress 4-1BB and TRAF1 in the HeLaTR
cells, t...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật